Stem-loop sequence mmu-mir-106b

AccessionMI0000407 (change log)
Symbol MGI:Mir106b
DescriptionMus musculus miR-106b stem-loop
Gene family MIPF0000001; mir-17
Literature search

113 open access papers mention mmu-mir-106b
(733 sentences)

Stem-loop
           ga -ua       g       agaua    uc u 
5' ccugcugg  c   aagugcu acagugc     gugg  c c
   ||||||||  |   ||||||| |||||||     ||||  | u
3' ggacgacc  g   uucaugg ugucacg     cauc  g c
           uc ucg       g       ----c    gu u 
Get sequence
Deep sequencing
438866 reads, 2.77e+03 reads per million, 114 experiments
Confidence Annotation confidence: high
Feedback: Do you believe this miRNA is real?
Comments

Reference [1] reported the same miRNA sequence with two different identifiers - miR-106b and miR-94.

Genome context
Coordinates (GRCm38; GCA_000001635.2) Overlapping transcripts
chr5: 138165737-138165818 [-]
sense
OTTMUST00000054328 ; Mcm7-002; intron 8
OTTMUST00000054327 ; Mcm7-001; intron 13
ENSMUST00000148879 ; Mcm7-002; intron 8
ENSMUST00000000505 ; Mcm7-001; intron 13
Clustered miRNAs
< 10kb from mmu-mir-106b
mmu-mir-106bchr5: 138165737-138165818 [-]
mmu-mir-93chr5: 138165523-138165610 [-]
mmu-mir-25chr5: 138165321-138165404 [-]
Database links

Mature sequence mmu-miR-106b-5p

Accession MIMAT0000386
Previous IDsmmu-miR-106b
Sequence

12 - 

uaaagugcugacagugcagau

 - 32

Get sequence
Deep sequencing385406 reads, 107 experiments
Evidence experimental; cloned [1-2], Illumina [3-4]
Database links
Predicted targets

Mature sequence mmu-miR-106b-3p

Accession MIMAT0004582
Previous IDsmmu-miR-106b*
Sequence

52 - 

ccgcacuguggguacuugcugc

 - 73

Get sequence
Deep sequencing53322 reads, 104 experiments
Evidence experimental; cloned [2], Illumina [3-4]
Database links
Predicted targets

References

1
PMID:12919684 "Embryonic stem cell-specific MicroRNAs" Houbaviy HB, Murray MF, Sharp PA Dev Cell. 5:351-358(2003).
2
PMID:17604727 "A mammalian microRNA expression atlas based on small RNA library sequencing" Landgraf P, Rusu M, Sheridan R, Sewer A, Iovino N, Aravin A, Pfeffer S, Rice A, Kamphorst AO, Landthaler M, Lin C, Socci ND, Hermida L, Fulci V, Chiaretti S, Foa R, Schliwka J, Fuchs U, Novosel A, Muller RU, Schermer B, Bissels U, Inman J, Phan Q, Chien M Cell. 129:1401-1414(2007).
3
PMID:20215419 "MicroRNA transcriptome in the newborn mouse ovaries determined by massive parallel sequencing" Ahn HW, Morin RD, Zhao H, Harris RA, Coarfa C, Chen ZJ, Milosavljevic A, Marra MA, Rajkovic A Mol Hum Reprod. 16:463-471(2010).
4
PMID:20413612 "Mammalian microRNAs: experimental evaluation of novel and previously annotated genes" Chiang HR, Schoenfeld LW, Ruby JG, Auyeung VC, Spies N, Baek D, Johnston WK, Russ C, Luo S, Babiarz JE, Blelloch R, Schroth GP, Nusbaum C, Bartel DP Genes Dev. 24:992-1009(2010).