![]() |
miRBase |
![]() |
![]() |
Stem-loop sequence mmu-let-7d |
||||||||
Accession | MI0000405 (change log) | |||||||
Symbol | MGI:Mirlet7d | |||||||
Description | Mus musculus let-7d stem-loop | |||||||
Gene family | MIPF0000002; let-7 | |||||||
Literature search |
![]()
436 open access papers mention mmu-let-7d | |||||||
Stem-loop |
uu a c -------uua 5' aauggg ccuagga gagguaguagguug auaguu gggcagag |||||| ||||||| |||||||||||||| |||||| ||||||| a 3' uuauuc ggauucu uuccgucguccagc uaucaa cccguuuu cg - a uugaggaaca |
|||||||
Deep sequencing |
| |||||||
Confidence |
Annotation confidence: high
| |||||||
Genome context |
|
|||||||
Clustered miRNAs |
|
|||||||
Database links |
|
Mature sequence mmu-let-7d-5p |
|
Accession | MIMAT0000383 |
Previous IDs | mmu-let-7d |
Sequence |
16 - agagguaguagguugcauaguu - 37 |
Deep sequencing | 7402977 reads, 107 experiments |
Evidence | experimental; cloned [1,3-5], Illumina [6-7] |
Database links |
|
Predicted targets |
|
Mature sequence mmu-let-7d-3p |
|
Accession | MIMAT0000384 |
Previous IDs | mmu-let-7d* |
Sequence |
70 - cuauacgaccugcugccuuucu - 91 |
Deep sequencing | 49885 reads, 106 experiments |
Evidence | experimental; cloned [2,5], Illumina [6-7] |
Database links |
|
Predicted targets |
|
References |
|
1 |
PMID:12007417
"Identification of tissue-specific microRNAs from mouse"
Curr Biol. 12:735-739(2002).
|
2 |
PMID:12919684
"Embryonic stem cell-specific MicroRNAs"
Dev Cell. 5:351-358(2003).
|
3 |
PMID:15538371
"A pancreatic islet-specific microRNA regulates insulin secretion"
Nature. 432:226-230(2004).
|
4 | |
5 |
PMID:17604727
"A mammalian microRNA expression atlas based on small RNA library sequencing"
Cell. 129:1401-1414(2007).
|
6 |
PMID:20215419
"MicroRNA transcriptome in the newborn mouse ovaries determined by massive parallel sequencing"
Mol Hum Reprod. 16:463-471(2010).
|
7 |
PMID:20413612
"Mammalian microRNAs: experimental evaluation of novel and previously annotated genes"
Genes Dev. 24:992-1009(2010).
|