![]() |
miRBase |
![]() |
![]() |
Stem-loop sequence mmu-mir-299a |
||||||||||||||||||||||||||||||||||
Accession | MI0000399 (change log) | |||||||||||||||||||||||||||||||||
Previous IDs | mmu-mir-299 | |||||||||||||||||||||||||||||||||
Symbol | MGI:Mir299a | |||||||||||||||||||||||||||||||||
Description | Mus musculus miR-299 stem-loop | |||||||||||||||||||||||||||||||||
Gene family | MIPF0000186; mir-299 | |||||||||||||||||||||||||||||||||
Literature search |
![]()
25 open access papers mention mmu-mir-299a | |||||||||||||||||||||||||||||||||
Stem-loop |
a uu 5' aagaa ugguuuaccgucccacauacau u ||||| |||||||||||||||||||||| g 3' uucuu gccaaauggcaggguguaugua a c ug |
|||||||||||||||||||||||||||||||||
Deep sequencing |
| |||||||||||||||||||||||||||||||||
Confidence |
Annotation confidence: high
| |||||||||||||||||||||||||||||||||
Genome context |
|
|||||||||||||||||||||||||||||||||
Clustered miRNAs |
|
|||||||||||||||||||||||||||||||||
Database links |
|
Mature sequence mmu-miR-299a-5p |
|
Accession | MIMAT0000377 |
Previous IDs | mmu-miR-299;mmu-miR-299*;mmu-miR-299-5p |
Sequence |
7 - ugguuuaccgucccacauacau - 28 |
Deep sequencing | 7643 reads, 71 experiments |
Evidence | experimental; cloned [1-2], Illumina [3-4] |
Database links |
|
Predicted targets |
|
Mature sequence mmu-miR-299a-3p |
|
Accession | MIMAT0004577 |
Previous IDs | mmu-miR-299;mmu-miR-299-3p |
Sequence |
39 - uaugugggacgguaaaccgcuu - 60 |
Deep sequencing | 25397 reads, 88 experiments |
Evidence | experimental; cloned [2], Illumina [3-4] |
Database links |
|
Predicted targets |
|
References |
|
1 |
PMID:12919684
"Embryonic stem cell-specific MicroRNAs"
Dev Cell. 5:351-358(2003).
|
2 |
PMID:17604727
"A mammalian microRNA expression atlas based on small RNA library sequencing"
Cell. 129:1401-1414(2007).
|
3 |
PMID:20215419
"MicroRNA transcriptome in the newborn mouse ovaries determined by massive parallel sequencing"
Mol Hum Reprod. 16:463-471(2010).
|
4 |
PMID:20413612
"Mammalian microRNAs: experimental evaluation of novel and previously annotated genes"
Genes Dev. 24:992-1009(2010).
|