Stem-loop sequence hsa-mir-221

Accession

MI0000298 (change log)

Symbol

HGNC:MIR221

Description

Homo sapiens miR-221 stem-loop

Gene family

MIPF0000051; mir-221

Literature search

572 open access papers mention hsa-mir-221
(4090 sentences)

Stem-loop

   -u     ----       cugg   a    -  ug   u         auuu    -   c 
5'   gaaca    uccaggu    ggc ugaa cc  gca acaauguag    cugu guu g
     |||||    |||||||    ||| |||| ||  ||| |||||||||    |||| ||| u
3'   cuugu    aggucca    ucg acuu gg  cgu uguuacauc    gaca cgg u
   cu     acaa       ----   g    u  gu   c         ----    a   a 

Deep sequencing

2336450 reads, 4.32e+03 reads per million, 159 experiments

Confidence

Annotation confidence: high

Feedback: Do you believe this miRNA is real?

Comments

This human miRNA was predicted by computational methods using conservation with mouse and Fugu rubripes sequences [1]. Expression of the excised miR has been validated in zebrafish, and later validated in human HL-60 leukemia cells [2].

Genome context

• Coordinates (GRCh38; GCA_000001405.15): chrX: 45746157-45746266 [-]
• Overlapping transcripts:

  intergenic

Clustered miRNAs

< 10kb from hsa-mir-221

• hsa-mir-222: chrX: 45747015-45747124 [-]
• hsa-mir-221: chrX: 45746157-45746266 [-]

Database links

• EntrezGene:MIR221
• HGNC:MIR221
• RNAcentral:URS0000245997_9606
• miRBase Tracker:MI0000298

Mature sequence hsa-miR-221-5p

• Accession: MIMAT0004568
• Previous IDs: hsa-miR-221*
• Sequence: 25 - accuggcauacaauguagauuu - 46
• Deep sequencing: 159083 reads, 151 experiments
• Evidence: experimental; cloned [3]
• Database links:
  • RNAcentral:URS0000593537_9606
• Predicted targets:
  • TargetMiner:hsa-miR-221-5p
  • TargetScanVert:hsa-miR-221-5p
  • miRDB:hsa-miR-221-5p
  • microrna.org:hsa-miR-221-5p

Mature sequence hsa-miR-221-3p

• Accession: MIMAT0000278
• Previous IDs: hsa-miR-221
• Sequence: 65 - agcuacauugucugcuggguuuc - 87
• Deep sequencing: 2177254 reads, 159 experiments
• Evidence: experimental; cloned [2-4], Illumina [5]
• Database links:
  • RNAcentral:URS0000170CF4_9606
• Predicted targets:
  • TargetMiner:hsa-miR-221-3p
  • TargetScanVert:hsa-miR-221-3p
  • miRDB:hsa-miR-221-3p
  • microrna.org:hsa-miR-221-3p

References

1. PMID:12624257 "Vertebrate microRNA genes" Lim LP, Glasner ME, Yekta S, Burge CB, Bartel DP Science. 299:1540(2003).
2. PMID:15325244 "Altered expression profiles of microRNAs during TPA-induced differentiation of HL-60 cells" Kasashima K, Nakamura Y, Kozu T Biochem Biophys Res Commun. 322:403-410(2004).
3. PMID:17604727 "A mammalian microRNA expression atlas based on small RNA library sequencing" Landgraf P, Rusu M, Sheridan R, Sewer A, Iovino N, Aravin A, Pfeffer S, Rice A, Kamphorst AO, Landthaler M, Lin C, Socci ND, Hermida L, Fulci V, Chiaretti S, Foa R, Schliwka J, Fuchs U, Novosel A, Muller RU, Schermer B, Bissels U, Inman J, Phan Q, Chien M Cell. 129:1401-1414(2007).
4. PMID:17616659 "Patterns of known and novel small RNAs in human cervical cancer" Lui WO, Pourmand N, Patterson BK, Fire A Cancer Res. 67:6031-6043(2007).
5. PMID:20158877 "Analysis of deep sequencing microRNA expression profile from human embryonic stem cells derived mesenchymal stem cells reveals possible role of let-7 microRNA family in downstream targeting of hepatic nuclear factor 4 alpha" Koh W, Sheng CT, Tan B, Lee QY, Kuznetsov V, Kiang LS, Tanavde V BMC Genomics. 11 Suppl 1:S6(2010).