Stem-loop sequence hsa-mir-203a

Accession

MI0000283 (change log)

Previous IDs

hsa-mir-203

Symbol

HGNC:MIR203A

Description

Homo sapiens miR-203a stem-loop

Gene family

MIPF0000108; mir-203

Literature search

297 open access papers mention hsa-mir-203a
(2703 sentences)

Stem-loop

   g     gg a u   g         c         u    g    a     - ug 
5'  uguug  g c cgc cgcuggguc agugguucu aaca uuca caguu c  u
    |||||  | | ||| ||||||||| ||||||||| |||| |||| ||||| |   
3'  gcgac  c g gcg gcggcccag ucaccagga uugu aagu guuaa g  a
   a     ag g c   g         a         u    a    -     c cg 

Deep sequencing

188200 reads, 524 reads per million, 147 experiments

Confidence

Annotation confidence: high

Feedback: Do you believe this miRNA is real?

Comments

This human miRNA was predicted by computational methods using conservation with mouse and Fugu rubripes sequences [1]. Expression of the excised miR has been validated in zebrafish, and the ends mapped by cloning. Landgraf et al. confirm expression in human [2].

Genome context

• Coordinates (GRCh38; GCA_000001405.15): chr14: 104117405-104117514 [+]
• Overlapping transcripts:

  sense

  OTTHUMT00000414859 ; KLC1-021; intron 1

  OTTHUMT00000402947 ; KLC1-001; intron 1

  OTTHUMT00000402944 ; KLC1-003; intron 1

  OTTHUMT00000414860 ; KLC1-022; intron 1

  OTTHUMT00000402945 ; KLC1-002; intron 1

  OTTHUMT00000414861 ; KLC1-009; intron 1

  OTTHUMT00000414862 ; KLC1-008; intron 1

  OTTHUMT00000402946 ; KLC1-005; intron 1

  OTTHUMT00000414863 ; KLC1-016; intron 1

  OTTHUMT00000414864 ; KLC1-010; intron 1

  OTTHUMT00000414866 ; KLC1-011; intron 1

  OTTHUMT00000414867 ; KLC1-013; intron 1

  OTTHUMT00000414868 ; KLC1-020; intron 1

  OTTHUMT00000402950 ; KLC1-004; intron 1

  OTTHUMT00000414869 ; KLC1-017; intron 1

  OTTHUMT00000414871 ; KLC1-015; intron 1

  OTTHUMT00000402943 ; RP11-73M18.2-001; intron 4

  ENST00000557172 ; KLC1-021; intron 1

  ENST00000348520 ; KLC1-001; intron 1

  ENST00000380038 ; KLC1-003; intron 1

  ENST00000555467 ; KLC1-022; intron 1

  ENST00000389744 ; KLC1-002; intron 1

  ENST00000557575 ; KLC1-009; intron 1

  ENST00000553286 ; KLC1-008; intron 1

  ENST00000347839 ; KLC1-005; intron 1

  ENST00000555836 ; KLC1-016; intron 1

  ENST00000334553 ; KLC1-010; intron 1

  ENST00000246489 ; KLC1-011; intron 1

  ENST00000554228 ; KLC1-013; intron 1

  ENST00000557450 ; KLC1-020; intron 1

  ENST00000452929 ; KLC1-004; intron 1

  ENST00000554280 ; KLC1-017; intron 1

  ENST00000445352 ; KLC1-015; intron 1

  ENST00000472726 ; RP11-73M18.2-001; intron 4

Clustered miRNAs

< 10kb from hsa-mir-203a

• hsa-mir-203a: chr14: 104117405-104117514 [+]
• hsa-mir-203b: chr14: 104117418-104117503 [-]

Database links

• EntrezGene:MIR203
• HGNC:MIR203A
• RNAcentral:URS000075ACBD_9606
• miRBase Tracker:MI0000283

Mature sequence hsa-miR-203a-5p

• Accession: MIMAT0031890
• Sequence: 27 - agugguucuuaacaguucaacaguu - 51
• Deep sequencing: 607 reads, 75 experiments
• Evidence: not experimental
• Database links:
  • RNAcentral:URS0000770B9E_9606
• Predicted targets:
  • TargetScanVert:hsa-miR-203a-5p
  • miRDB:hsa-miR-203a-5p

Mature sequence hsa-miR-203a-3p

• Accession: MIMAT0000264
• Previous IDs: hsa-miR-203a
• Sequence: 65 - gugaaauguuuaggaccacuag - 86
• Deep sequencing: 187572 reads, 147 experiments
• Evidence: experimental; cloned [2]
• Database links:
  • RNAcentral:URS00004DA9DB_9606
• Predicted targets:
  • miRDB:hsa-miR-203a-3p
  • microrna.org:hsa-miR-203a-3p

References

1. PMID:12624257 "Vertebrate microRNA genes" Lim LP, Glasner ME, Yekta S, Burge CB, Bartel DP Science. 299:1540(2003).
2. PMID:17604727 "A mammalian microRNA expression atlas based on small RNA library sequencing" Landgraf P, Rusu M, Sheridan R, Sewer A, Iovino N, Aravin A, Pfeffer S, Rice A, Kamphorst AO, Landthaler M, Lin C, Socci ND, Hermida L, Fulci V, Chiaretti S, Foa R, Schliwka J, Fuchs U, Novosel A, Muller RU, Schermer B, Bissels U, Inman J, Phan Q, Chien M Cell. 129:1401-1414(2007).
3. PMID:17622355 "MicroRNAs: novel regulators involved in the pathogenesis of psoriasis?" Sonkoly E, Wei T, Janson PC, Saaf A, Lundeberg L, Tengvall-Linder M, Norstedt G, Alenius H, Homey B, Scheynius A, Stahle M, Pivarcsi A PLoS One. 2:e610(2007).