Stem-loop sequence mmu-mir-204

AccessionMI0000247 (change log)
Symbol MGI:Mir204
DescriptionMus musculus miR-204 stem-loop
Gene family MIPF0000042; mir-204
Literature search

84 open access papers mention mmu-mir-204
(848 sentences)

Stem-loop
   u    u          a     u    gagaau 
5'  ggac ucccuuuguc uccua gccu      a
    |||| |||||||||| ||||| ||||      u
3'  cuug agggaaacgg agggu cgga      a
   a    c          a     -    ggaagu 
Get sequence
Deep sequencing
34557 reads, 69.6 reads per million, 79 experiments
Confidence Annotation confidence: high
Feedback: Do you believe this miRNA is real?
Comments

The mature sequence shown here represents the most commonly cloned form from large-scale cloning studies [3].

Genome context
Coordinates (GRCm38; GCA_000001635.2) Overlapping transcripts
chr19: 22750605-22750672 [+]
sense
ENSMUST00000083573 ; Mir204-201; exon 1
ENSMUST00000099569 ; Trpm3-206; intron 6
ENSMUST00000087576 ; Trpm3-203; intron 6
ENSMUST00000074770 ; Trpm3-202; intron 6
ENSMUST00000037901 ; Trpm3-201; intron 6
ENSMUST00000099566 ; Trpm3-205; intron 6
ENSMUST00000099564 ; Trpm3-204; intron 7
Database links

Mature sequence mmu-miR-204-5p

Accession MIMAT0000237
Previous IDsmmu-miR-204
Sequence

6 - 

uucccuuugucauccuaugccu

 - 27

Get sequence
Deep sequencing33017 reads, 72 experiments
Evidence experimental; cloned [1-3], Illumina [4-5]
Database links
Predicted targets

Mature sequence mmu-miR-204-3p

Accession MIMAT0017002
Previous IDsmmu-miR-204*
Sequence

45 - 

gcugggaaggcaaagggacgu

 - 65

Get sequence
Deep sequencing1513 reads, 42 experiments
Evidence experimental; Illumina [5]
Database links
Predicted targets

References

1
PMID:12554859 "New microRNAs from mouse and human" Lagos-Quintana M, Rauhut R, Meyer J, Borkhardt A, Tuschl T RNA. 9:175-179(2003).
2
3
PMID:17604727 "A mammalian microRNA expression atlas based on small RNA library sequencing" Landgraf P, Rusu M, Sheridan R, Sewer A, Iovino N, Aravin A, Pfeffer S, Rice A, Kamphorst AO, Landthaler M, Lin C, Socci ND, Hermida L, Fulci V, Chiaretti S, Foa R, Schliwka J, Fuchs U, Novosel A, Muller RU, Schermer B, Bissels U, Inman J, Phan Q, Chien M Cell. 129:1401-1414(2007).
4
PMID:20215419 "MicroRNA transcriptome in the newborn mouse ovaries determined by massive parallel sequencing" Ahn HW, Morin RD, Zhao H, Harris RA, Coarfa C, Chen ZJ, Milosavljevic A, Marra MA, Rajkovic A Mol Hum Reprod. 16:463-471(2010).
5
PMID:20413612 "Mammalian microRNAs: experimental evaluation of novel and previously annotated genes" Chiang HR, Schoenfeld LW, Ruby JG, Auyeung VC, Spies N, Baek D, Johnston WK, Russ C, Luo S, Babiarz JE, Blelloch R, Schroth GP, Nusbaum C, Bartel DP Genes Dev. 24:992-1009(2010).