Stem-loop sequence mmu-mir-199a-1

AccessionMI0000241 (change log)
Previous IDsmmu-mir-199-as;mmu-mir-199
Symbol MGI:Mir199a-1
DescriptionMus musculus miR-199a-1 stem-loop
Gene family MIPF0000040; mir-199
Literature search

163 open access papers mention mmu-mir-199a-1
(1252 sentences)

Stem-loop 
      auc       u        c   -------    g 
5' gcc   ccagugu cagacuac ugu       ucag a
   |||   ||||||| |||||||| |||       ||||  
3' cgg   gguuaca gucugaug aca       gguc g
      auu       c        -   uguacag    g
Get sequence
Deep sequencing
4159480 reads, 1.7e+04 reads per million, 106 experiments
Confidence Annotation confidence: high
Feedback: Do you believe this miRNA is real?
Comments

The hairpin precursor sequence mir-199 maps to two loci within 50 kb on mouse chromosome 9. This sequence was named mir-199 in [1] and [2], but is renamed here to avoid overlap with the predicted homologues of human mir-199a-2 and mir-199b. Landgraf et al. demonstrate comparable expression for products from both arms of the hairpin, which are therefore renamed miR-199a-5p and miR-199a-3p here [4]. The mature sequences shown here represent the most commonly cloned forms from large-scale cloning studies [4]. The 5' end of the miRNA may be offset with respect to previous annotations.

Genome context
Coordinates (GRCm38; GCA_000001635.2) Overlapping transcripts
chr9: 21496495-21496564 [-]
antisense
OTTMUST00000098127 ; Dnm2-011; intron 1
OTTMUST00000098115 ; Dnm2-006; intron 6
OTTMUST00000098123 ; Dnm2-010; intron 9
OTTMUST00000098112 ; Dnm2-005; intron 14
OTTMUST00000098113 ; Dnm2-002; intron 14
OTTMUST00000098109 ; Dnm2-001; intron 15
OTTMUST00000098110 ; Dnm2-003; intron 15
OTTMUST00000098111 ; Dnm2-004; intron 15
OTTMUST00000098121 ; Dnm2-008; intron 15
ENSMUST00000173299 ; Dnm2-011; intron 1
ENSMUST00000172763 ; Dnm2-006; intron 6
ENSMUST00000172833 ; Dnm2-010; intron 9
ENSMUST00000091087 ; Dnm2-005; intron 14
ENSMUST00000174050 ; Dnm2-002; intron 14
ENSMUST00000165766 ; Dnm2-001; intron 15
ENSMUST00000173397 ; Dnm2-003; intron 15
ENSMUST00000072362 ; Dnm2-004; intron 15
ENSMUST00000172482 ; Dnm2-008; intron 15
ENSMUST00000115404 ; Dnm2-201; intron 15
Database links

Mature sequence mmu-miR-199a-5p

Accession MIMAT0000229
Previous IDsmmu-miR-199a
Sequence

6 -  

cccaguguucagacuaccuguuc

 - 28

Get sequence
Deep sequencing1057387 reads, 91 experiments
Evidence experimental; cloned [5], Illumina [6-7]
Database links
Predicted targets

Mature sequence mmu-miR-199a-3p

Accession MIMAT0000230
Previous IDsmmu-miR-199a*
Sequence

46 -  

acaguagucugcacauugguua

 - 67

Get sequence
Deep sequencing7264843 reads, 106 experiments
Evidence experimental; cloned [1,5], Illumina [6-7]
Database links
Predicted targets

References

1
PMID:12554859 "New microRNAs from mouse and human" Lagos-Quintana M, Rauhut R, Meyer J, Borkhardt A, Tuschl T RNA. 9:175-179(2003).
2
PMID:12919684 "Embryonic stem cell-specific MicroRNAs" Houbaviy HB, Murray MF, Sharp PA Dev Cell. 5:351-358(2003).
3
PMID:12554860 "Numerous microRNPs in neuronal cells containing novel microRNAs" Dostie J, Mourelatos Z, Yang M, Sharma A, Dreyfuss G RNA. 9:180-186(2003).
4
PMID:17604727 "A mammalian microRNA expression atlas based on small RNA library sequencing" Landgraf P, Rusu M, Sheridan R, Sewer A, Iovino N, Aravin A, Pfeffer S, Rice A, Kamphorst AO, Landthaler M, Lin C, Socci ND, Hermida L, Fulci V, Chiaretti S, Foa R, Schliwka J, Fuchs U, Novosel A, Muller RU, Schermer B, Bissels U, Inman J, Phan Q, Chien M Cell. 129:1401-1414(2007).
5
PMID:20215419 "MicroRNA transcriptome in the newborn mouse ovaries determined by massive parallel sequencing" Ahn HW, Morin RD, Zhao H, Harris RA, Coarfa C, Chen ZJ, Milosavljevic A, Marra MA, Rajkovic A Mol Hum Reprod. 16:463-471(2010).
6
PMID:20413612 "Mammalian microRNAs: experimental evaluation of novel and previously annotated genes" Chiang HR, Schoenfeld LW, Ruby JG, Auyeung VC, Spies N, Baek D, Johnston WK, Russ C, Luo S, Babiarz JE, Blelloch R, Schroth GP, Nusbaum C, Bartel DP Genes Dev. 24:992-1009(2010).