![]() |
miRBase |
![]() |
![]() |
Stem-loop sequence mmu-mir-195a |
||||||||
Accession | MI0000237 (change log) | |||||||
Previous IDs | mmu-mir-195 | |||||||
Symbol | MGI:Mir195a | |||||||
Description | Mus musculus miR-195 stem-loop | |||||||
Gene family | MIPF0000006; mir-15 | |||||||
Literature search |
![]()
100 open access papers mention mmu-mir-195a | |||||||
Stem-loop |
a ca - cucu -a u gga 5' cacc acucu ccugg agcagcacag aauauuggca gg a |||| ||||| ||||| |||||||||| |||||||||| || g 3' gugg uggga ggacc ucgucguguc uuauaaccgu cu u a -- c ---- gg - gag |
|||||||
Deep sequencing |
| |||||||
Confidence |
Annotation confidence: high
| |||||||
Genome context |
|
|||||||
Clustered miRNAs |
|
|||||||
Database links |
|
Mature sequence mmu-miR-195a-5p |
|
Accession | MIMAT0000225 |
Previous IDs | mmu-miR-195;mmu-miR-195-5p |
Sequence |
21 - uagcagcacagaaauauuggc - 41 |
Deep sequencing | 161095 reads, 107 experiments |
Evidence | experimental; cloned [1-3], Illumina [4,6] |
Database links |
|
Predicted targets |
|
Mature sequence mmu-miR-195a-3p |
|
Accession | MIMAT0017000 |
Previous IDs | mmu-miR-195*;mmu-miR-195-3p |
Sequence |
59 - ccaauauuggcugugcugcucc - 80 |
Deep sequencing | 2436 reads, 55 experiments |
Evidence | experimental; 454 [5], Illumina [6] |
Database links |
|
Predicted targets |
|
References |
|
1 |
PMID:12554859
"New microRNAs from mouse and human"
RNA. 9:175-179(2003).
|
2 |
PMID:15538371
"A pancreatic islet-specific microRNA regulates insulin secretion"
Nature. 432:226-230(2004).
|
3 |
PMID:17604727
"A mammalian microRNA expression atlas based on small RNA library sequencing"
Cell. 129:1401-1414(2007).
|
4 |
PMID:20215419
"MicroRNA transcriptome in the newborn mouse ovaries determined by massive parallel sequencing"
Mol Hum Reprod. 16:463-471(2010).
|
5 |
PMID:20668074
"Identification and analysis of expression of novel microRNAs of murine gammaherpesvirus 68"
J Virol. 84:10266-10275(2010).
|
6 |
PMID:20413612
"Mammalian microRNAs: experimental evaluation of novel and previously annotated genes"
Genes Dev. 24:992-1009(2010).
|