Stem-loop sequence mmu-mir-193a

Accession

MI0000235 (change log)

Previous IDs

mmu-mir-193

Symbol

MGI:Mir193a

Description

Mus musculus miR-193 stem-loop

Gene family

MIPF0000082; mir-193

Literature search

52 open access papers mention mmu-mir-193a
(559 sentences)

Stem-loop

      ag     u     cg   a  a    agu 
5' gag  cuggg cuuug  ggc ag ugag   g
   |||  ||||| |||||  ||| || ||||    
3' cuc  gaccc gaaac  ccg uc acuu   u
      cu     u     au   g  a    gac 

Deep sequencing

57928 reads, 391 reads per million, 101 experiments

Confidence

Annotation confidence: high

Feedback: Do you believe this miRNA is real?

Comments

The mature sequence shown here represents the most commonly cloned form from large-scale cloning studies [3].

Genome context

• Coordinates (GRCm38; GCA_000001635.2): chr11: 79711969-79712034 [+]
• Overlapping transcripts:

  intergenic

Database links

• EntrezGene:Mirn193
• MGI:Mir193a
• RNAcentral:URS000075B5F0_10090
• miRBase Tracker:MI0000235

Mature sequence mmu-miR-193a-5p

• Accession: MIMAT0004544
• Previous IDs: mmu-miR-193*;mmu-miR-193-5p
• Sequence: 7 - ugggucuuugcgggcaagauga - 28
• Deep sequencing: 9498 reads, 90 experiments
• Evidence: experimental; cloned [3], Illumina [4-5]
• Database links:
  • RNAcentral:URS00004DE9D7_10090
• Predicted targets:
  • TargetScanVert:mmu-miR-193a-5p
  • miRDB:mmu-miR-193a-5p
  • microrna.org:mmu-miR-193a-5p

Mature sequence mmu-miR-193a-3p

• Accession: MIMAT0000223
• Previous IDs: mmu-miR-193;mmu-miR-193-3p
• Sequence: 41 - aacuggccuacaaagucccagu - 62
• Deep sequencing: 48430 reads, 98 experiments
• Evidence: experimental; cloned [1-3], Northern [2], Illumina [4-5]
• Database links:
  • RNAcentral:URS00005DBAF3_10090
• Predicted targets:
  • TargetScanVert:mmu-miR-193a-3p
  • miRDB:mmu-miR-193a-3p
  • microrna.org:mmu-miR-193a-3p

References

1. PMID:12554859 "New microRNAs from mouse and human" Lagos-Quintana M, Rauhut R, Meyer J, Borkhardt A, Tuschl T RNA. 9:175-179(2003).
2. PMID:12919684 "Embryonic stem cell-specific MicroRNAs" Houbaviy HB, Murray MF, Sharp PA Dev Cell. 5:351-358(2003).
3. PMID:17604727 "A mammalian microRNA expression atlas based on small RNA library sequencing" Landgraf P, Rusu M, Sheridan R, Sewer A, Iovino N, Aravin A, Pfeffer S, Rice A, Kamphorst AO, Landthaler M, Lin C, Socci ND, Hermida L, Fulci V, Chiaretti S, Foa R, Schliwka J, Fuchs U, Novosel A, Muller RU, Schermer B, Bissels U, Inman J, Phan Q, Chien M Cell. 129:1401-1414(2007).
4. PMID:20215419 "MicroRNA transcriptome in the newborn mouse ovaries determined by massive parallel sequencing" Ahn HW, Morin RD, Zhao H, Harris RA, Coarfa C, Chen ZJ, Milosavljevic A, Marra MA, Rajkovic A Mol Hum Reprod. 16:463-471(2010).
5. PMID:20413612 "Mammalian microRNAs: experimental evaluation of novel and previously annotated genes" Chiang HR, Schoenfeld LW, Ruby JG, Auyeung VC, Spies N, Baek D, Johnston WK, Russ C, Luo S, Babiarz JE, Blelloch R, Schroth GP, Nusbaum C, Bartel DP Genes Dev. 24:992-1009(2010).