![]() |
miRBase |
![]() |
![]() |
Stem-loop sequence mmu-mir-129-1 |
|||||
Accession | MI0000222 (change log) | ||||
Previous IDs | mmu-mir-129b | ||||
Symbol | MGI:Mir129-1 | ||||
Description | Mus musculus miR-129-1 stem-loop | ||||
Gene family | MIPF0000073; mir-129 | ||||
Literature search |
![]()
52 open access papers mention mmu-mir-129-1 | ||||
Stem-loop |
- c cu g uu - c 5' uggau cuuuuug ggu gggcuu cug cu cu g ||||| ||||||| ||| |||||| ||| || || 3' aucua gaaaaac cca cccgaa gac ga ga a u c uu g -u u c |
||||
Deep sequencing |
| ||||
Confidence |
Annotation confidence: high
| ||||
Comments |
The mature sequence shown here represents the most commonly cloned form from large-scale cloning studies [4]. |
||||
Genome context |
|
||||
Database links |
|
Mature sequence mmu-miR-129-5p |
|
Accession | MIMAT0000209 |
Previous IDs | mmu-miR-129 |
Sequence |
6 - cuuuuugcggucugggcuugc - 26 |
Deep sequencing | 325625 reads, 97 experiments |
Evidence | experimental; cloned [1,3-4], Illumina [5-6] |
Database links |
|
Predicted targets |
|
Mature sequence mmu-miR-129-1-3p |
|
Accession | MIMAT0016994 |
Sequence |
49 - aagcccuuaccccaaaaaguau - 70 |
Deep sequencing | 45758 reads, 96 experiments |
Evidence | experimental; Illumina [6] |
Database links |
|
Predicted targets |
|
References |
|
1 |
PMID:12007417
"Identification of tissue-specific microRNAs from mouse"
Curr Biol. 12:735-739(2002).
|
2 |
PMID:12554859
"New microRNAs from mouse and human"
RNA. 9:175-179(2003).
|
3 |
PMID:15538371
"A pancreatic islet-specific microRNA regulates insulin secretion"
Nature. 432:226-230(2004).
|
4 |
PMID:17604727
"A mammalian microRNA expression atlas based on small RNA library sequencing"
Cell. 129:1401-1414(2007).
|
5 |
PMID:20215419
"MicroRNA transcriptome in the newborn mouse ovaries determined by massive parallel sequencing"
Mol Hum Reprod. 16:463-471(2010).
|
6 |
PMID:20413612
"Mammalian microRNAs: experimental evaluation of novel and previously annotated genes"
Genes Dev. 24:992-1009(2010).
|