Stem-loop sequence mmu-mir-152

Accession

MI0000174 (change log)

Symbol

MGI:Mir152

Description

Mus musculus miR-152 stem-loop

Gene family

MIPF0000056; mir-148

Literature search

64 open access papers mention mmu-mir-152
(268 sentences)

Stem-loop

                    g  a    cc    cgg   c 
5' ccgggccuagguucugu au cacu  gacu   gcu u
   ||||||||||||||||| || ||||  ||||   |||  
3' ggcccggguucaagaca ua guga  cuga   cga g
                    g  c    --    ---   g 

Deep sequencing

757282 reads, 2.26e+03 reads per million, 118 experiments

Confidence

Annotation confidence: high

Feedback: Do you believe this miRNA is real?

Comments

The mature sequence shown here represents the most commonly cloned form from large-scale cloning studies [4].

Genome context

• Coordinates (GRCm38; GCA_000001635.2): chr11: 96850393-96850465 [+]
• Overlapping transcripts:

  sense

  OTTMUST00000003413 ; Copz2-002; intron 1

  OTTMUST00000003223 ; Copz2-001; intron 1

  OTTMUST00000003414 ; Copz2-003; intron 1

  ENSMUST00000155696 ; Copz2-002; intron 1

  ENSMUST00000018816 ; Copz2-001; intron 1

  ENSMUST00000145633 ; Copz2-003; intron 1

Database links

• EntrezGene:Mir152
• MGI:Mir152
• RNAcentral:URS000075E619_10090
• miRBase Tracker:MI0000174

Mature sequence mmu-miR-152-5p

• Accession: MIMAT0016991
• Previous IDs: mmu-miR-152*
• Sequence: 8 - uagguucugugauacacuccgacu - 31
• Deep sequencing: 11479 reads, 74 experiments
• Evidence: experimental; 454 [6], Illumina [7]
• Database links:
  • RNAcentral:URS000059EF7A_10090
• Predicted targets:
  • TargetScanVert:mmu-miR-152-5p
  • miRDB:mmu-miR-152-5p

Mature sequence mmu-miR-152-3p

• Accession: MIMAT0000162
• Previous IDs: mmu-miR-152
• Sequence: 47 - ucagugcaugacagaacuugg - 67
• Deep sequencing: 745781 reads, 109 experiments
• Evidence: experimental; cloned [1-4], Illumina [5,7]
• Database links:
  • RNAcentral:URS00003AFD9B_10090
• Predicted targets:
  • TargetScanVert:mmu-miR-152-3p
  • miRDB:mmu-miR-152-3p
  • microrna.org:mmu-miR-152-3p

References

1. PMID:12007417 "Identification of tissue-specific microRNAs from mouse" Lagos-Quintana M, Rauhut R, Yalcin A, Meyer J, Lendeckel W, Tuschl T Curr Biol. 12:735-739(2002).
2. PMID:15538371 "A pancreatic islet-specific microRNA regulates insulin secretion" Poy MN, Eliasson L, Krutzfeldt J, Kuwajima S, Ma X, Macdonald PE, Pfeffer S, Tuschl T, Rajewsky N, Rorsman P, Stoffel M Nature. 432:226-230(2004).
3. PMID:16766679 "Identification and characterization of two novel classes of small RNAs in the mouse germline: retrotransposon-derived siRNAs in oocytes and germline small RNAs in testes" Watanabe T, Takeda A, Tsukiyama T, Mise K, Okuno T, Sasaki H, Minami N, Imai H Genes Dev. 20:1732-1743(2006).
4. PMID:17604727 "A mammalian microRNA expression atlas based on small RNA library sequencing" Landgraf P, Rusu M, Sheridan R, Sewer A, Iovino N, Aravin A, Pfeffer S, Rice A, Kamphorst AO, Landthaler M, Lin C, Socci ND, Hermida L, Fulci V, Chiaretti S, Foa R, Schliwka J, Fuchs U, Novosel A, Muller RU, Schermer B, Bissels U, Inman J, Phan Q, Chien M Cell. 129:1401-1414(2007).
5. PMID:20215419 "MicroRNA transcriptome in the newborn mouse ovaries determined by massive parallel sequencing" Ahn HW, Morin RD, Zhao H, Harris RA, Coarfa C, Chen ZJ, Milosavljevic A, Marra MA, Rajkovic A Mol Hum Reprod. 16:463-471(2010).
6. PMID:20668074 "Identification and analysis of expression of novel microRNAs of murine gammaherpesvirus 68" Zhu JY, Strehle M, Frohn A, Kremmer E, Hofig KP, Meister G, Adler H J Virol. 84:10266-10275(2010).
7. PMID:20413612 "Mammalian microRNAs: experimental evaluation of novel and previously annotated genes" Chiang HR, Schoenfeld LW, Ruby JG, Auyeung VC, Spies N, Baek D, Johnston WK, Russ C, Luo S, Babiarz JE, Blelloch R, Schroth GP, Nusbaum C, Bartel DP Genes Dev. 24:992-1009(2010).