Stem-loop sequence hsa-mir-105-1

AccessionMI0000111 (change log)
Previous IDshsa-mir-105-X.1
Symbol HGNC:MIR105-1
DescriptionHomo sapiens miR-105-1 stem-loop
Gene family MIPF0000074; mir-105
Literature search

35 open access papers mention hsa-mir-105-1
(55 sentences)

Stem-loop
   ugu         u  a          uc        g ug 
5'    gcaucgugg ca augcucagac  cuguggug c  c
      ||||||||| || ||||||||||  |||||||| |  u
3'    uguggcauc gu uacgaguuug  ggcaccac g  c
   auc         -  g          ua        - ua 
Get sequence
Deep sequencing
2750 reads, 15.7 reads per million, 70 experiments
Confidence Annotation confidence: high
Feedback: Do you believe this miRNA is real?
Comments

Mourelatos et al. [1] reported two identical predicted stem loop sequences located on chromosome X, which they named mir-105-X.1 and mir-105-X.2. These sequences have been renamed mir-105-1 (MI0000111) and mir-105-2 (MI0000112) here. mir-105-2 differs slightly from that published in [1] and deposited in EMBL (EMBL:AF480548). The mature sequence shown here represents the most commonly cloned form from large-scale cloning studies [2].

Genome context
Coordinates (GRCh38; GCA_000001405.15) Overlapping transcripts
chrX: 152392219-152392299 [-]
sense
OTTHUMT00000144474 ; AC151961.1-001; intron 1
ENST00000456193 ; AC151961.1-001; intron 1
Clustered miRNAs
< 10kb from hsa-mir-105-1
hsa-mir-105-2chrX: 152394412-152394492 [-]
hsa-mir-767chrX: 152393421-152393529 [-]
hsa-mir-105-1chrX: 152392219-152392299 [-]
Database links

Mature sequence hsa-miR-105-5p

Accession MIMAT0000102
Previous IDshsa-miR-105
Sequence

13 - 

ucaaaugcucagacuccuguggu

 - 35

Get sequence
Deep sequencing4506 reads, 61 experiments
Evidence experimental; cloned [1-2]
Database links
Predicted targets

Mature sequence hsa-miR-105-3p

Accession MIMAT0004516
Previous IDshsa-miR-105*
Sequence

51 - 

acggauguuugagcaugugcua

 - 72

Get sequence
Deep sequencing983 reads, 29 experiments
Evidence experimental; cloned [2]
Database links
Predicted targets

References

1
PMID:11914277 "miRNPs: a novel class of ribonucleoproteins containing numerous microRNAs" Mourelatos Z, Dostie J, Paushkin S, Sharma A, Charroux B, Abel L, Rappsilber J, Mann M, Dreyfuss G Genes Dev. 16:720-728(2002).
2
PMID:17604727 "A mammalian microRNA expression atlas based on small RNA library sequencing" Landgraf P, Rusu M, Sheridan R, Sewer A, Iovino N, Aravin A, Pfeffer S, Rice A, Kamphorst AO, Landthaler M, Lin C, Socci ND, Hermida L, Fulci V, Chiaretti S, Foa R, Schliwka J, Fuchs U, Novosel A, Muller RU, Schermer B, Bissels U, Inman J, Phan Q, Chien M Cell. 129:1401-1414(2007).