Stem-loop sequence hsa-mir-101-1

Accession

MI0000103 (change log)

Previous IDs

hsa-mir-101-1;hsa-mir-101

Symbol

HGNC:MIR101-1

Description

Homo sapiens miR-101-1 stem-loop

Gene family

MIPF0000046; mir-101

Literature search

307 open access papers mention hsa-mir-101-1
(2215 sentences)

Stem-loop

   u   cuggc                  a    gucua 
5'  gcc     ucaguuaucacagugcug ugcu     u
    |||     |||||||||||||||||| ||||      
3'  cgg     agucaauagugucaugac augg     u
   a   uagga                  -    aaauc 

Deep sequencing

3005547 reads, 6.06e+03 reads per million, 159 experiments

Confidence

Annotation confidence: high

Feedback: Do you believe this miRNA is real?

Comments

Reference [1] reports two miR-101 precursor hairpin structures in human, on chromosome 1 (MI0000103) and 9 (MI0000739, named mir-101-precursor-9 in [1]). The mature sequence shown here represents the most commonly cloned form from large-scale cloning studies [3].

Genome context

• Coordinates (GRCh38; GCA_000001405.15): chr1: 65058434-65058508 [-]
• Overlapping transcripts:

  antisense

  OTTHUMT00000025033 ; CACHD1-002; intron 2

  OTTHUMT00000025238 ; CACHD1-001; intron 3

  OTTHUMT00000025032 ; CACHD1-003; intron 3

  ENST00000470527 ; CACHD1-002; intron 2

  ENST00000290039 ; CACHD1-001; intron 3

  ENST00000495994 ; CACHD1-003; intron 3

  ENST00000371073 ; CACHD1-201; intron 3

Clustered miRNAs

< 10kb from hsa-mir-101-1

• hsa-mir-101-1: chr1: 65058434-65058508 [-]
• hsa-mir-3671: chr1: 65057755-65057842 [-]

Database links

• EntrezGene:MIR101-1
• HGNC:MIR101-1
• RNAcentral:URS0000370AC5_9606
• miRBase Tracker:MI0000103

Mature sequence hsa-miR-101-5p

• Accession: MIMAT0004513
• Previous IDs: hsa-miR-101*
• Sequence: 11 - caguuaucacagugcugaugcu - 32
• Deep sequencing: 5220 reads, 135 experiments
• Evidence: experimental; cloned [3-4]
• Database links:
  • RNAcentral:URS000017D10B_9606
• Predicted targets:
  • TargetMiner:hsa-miR-101-5p
  • TargetScanVert:hsa-miR-101-5p
  • miRDB:hsa-miR-101-5p
  • microrna.org:hsa-miR-101-5p

Mature sequence hsa-miR-101-3p

• Accession: MIMAT0000099
• Previous IDs: hsa-miR-101
• Sequence: 47 - uacaguacugugauaacugaa - 67
• Deep sequencing: 6029564 reads, 159 experiments
• Evidence: experimental; cloned [1-4]
• Database links:
  • RNAcentral:URS00001230A0_9606
• Predicted targets:
  • TargetMiner:hsa-miR-101-3p
  • TargetScanVert:hsa-miR-101-3p.1
  • miRDB:hsa-miR-101-3p
  • microrna.org:hsa-miR-101-3p

References

1. PMID:11914277 "miRNPs: a novel class of ribonucleoproteins containing numerous microRNAs" Mourelatos Z, Dostie J, Paushkin S, Sharma A, Charroux B, Abel L, Rappsilber J, Mann M, Dreyfuss G Genes Dev. 16:720-728(2002).
2. PMID:15325244 "Altered expression profiles of microRNAs during TPA-induced differentiation of HL-60 cells" Kasashima K, Nakamura Y, Kozu T Biochem Biophys Res Commun. 322:403-410(2004).
3. PMID:17604727 "A mammalian microRNA expression atlas based on small RNA library sequencing" Landgraf P, Rusu M, Sheridan R, Sewer A, Iovino N, Aravin A, Pfeffer S, Rice A, Kamphorst AO, Landthaler M, Lin C, Socci ND, Hermida L, Fulci V, Chiaretti S, Foa R, Schliwka J, Fuchs U, Novosel A, Muller RU, Schermer B, Bissels U, Inman J, Phan Q, Chien M Cell. 129:1401-1414(2007).
4. PMID:17616659 "Patterns of known and novel small RNAs in human cervical cancer" Lui WO, Pourmand N, Patterson BK, Fire A Cancer Res. 67:6031-6043(2007).