Stem-loop sequence hsa-mir-30a

Accession

MI0000088 (change log)

Previous IDs

hsa-mir-30

Symbol

HGNC:MIR30A

Description

Homo sapiens miR-30a stem-loop

Gene family

MIPF0000005; mir-30

Literature search

486 open access papers mention hsa-mir-30a
(2440 sentences)

Stem-loop

      a            uc           -----   a 
5' gcg cuguaaacaucc  gacuggaagcu     gug a
   ||| ||||||||||||  |||||||||||     |||  
3' cgu gacguuuguagg  cugacuuucgg     cac g
      c            --           guaga   c 

Deep sequencing

9652297 reads, 1.51e+04 reads per million, 159 experiments

Confidence

Annotation confidence: high

Feedback: Do you believe this miRNA is real?

Comments

The mature sequences miR-30 [1] and miR-97 [2] appear to originate from the same precursor. Subsequent data confirm that both arms of the precursor appear to give rise to mature miRNA sequences (Pfeffer S, pers. comm.). Landgraf et al. later showed that the 5' product is the predominant one [5]. Related miRNAs are processed from the 5' arms of other precursor loci (mir-30b, MI0000441; mir-30c-1, MI0000736; mir-30c-2, MI0000254; mir-30d, MI0000255; mir-30e, MI0000749).

Genome context

• Coordinates (GRCh38; GCA_000001405.15): chr6: 71403551-71403621 [-]
• Overlapping transcripts:

  antisense

  OTTHUMT00000041147 ; SMAP1-003; intron 1

  OTTHUMT00000041148 ; SMAP1-004; intron 1

  OTTHUMT00000041149 ; SMAP1-005; intron 1

  OTTHUMT00000436306 ; RP11-160A9.3-001; exon 1

  ENST00000370452 ; SMAP1-003; intron 1

  ENST00000316999 ; SMAP1-004; intron 1

  ENST00000370455 ; SMAP1-005; intron 1

  ENST00000422334 ; SMAP1-201; intron 1

  ENST00000572103 ; RP11-160A9.3-001; exon 1

Database links

• EntrezGene:MIR30A
• HGNC:MIR30A
• RNAcentral:URS000043D261_9606
• miRBase Tracker:MI0000088

Mature sequence hsa-miR-30a-5p

• Accession: MIMAT0000087
• Previous IDs: hsa-miR-30a-5p;hsa-miR-30a
• Sequence: 6 - uguaaacauccucgacuggaag - 27
• Deep sequencing: 8859499 reads, 159 experiments
• Evidence: experimental; cloned [2,4-6]
• Database links:
  • RNAcentral:URS000043D1A9_9606
• Predicted targets:
  • TargetMiner:hsa-miR-30a-5p
  • TargetScanVert:hsa-miR-30a-5p
  • miRDB:hsa-miR-30a-5p
  • microrna.org:hsa-miR-30a-5p

Mature sequence hsa-miR-30a-3p

• Accession: MIMAT0000088
• Previous IDs: hsa-miR-30a-3p;hsa-miR-30a*
• Sequence: 47 - cuuucagucggauguuugcagc - 68
• Deep sequencing: 792782 reads, 159 experiments
• Evidence: experimental; cloned [1,4-5], Northern [1]
• Database links:
  • RNAcentral:URS0000065D58_9606
• Predicted targets:
  • TargetMiner:hsa-miR-30a-3p
  • TargetScanVert:hsa-miR-30a-3p
  • miRDB:hsa-miR-30a-3p
  • microrna.org:hsa-miR-30a-3p

References

1. PMID:11679670 "Identification of novel genes coding for small expressed RNAs" Lagos-Quintana M, Rauhut R, Lendeckel W, Tuschl T Science. 294:853-858(2001).
2. PMID:11914277 "miRNPs: a novel class of ribonucleoproteins containing numerous microRNAs" Mourelatos Z, Dostie J, Paushkin S, Sharma A, Charroux B, Abel L, Rappsilber J, Mann M, Dreyfuss G Genes Dev. 16:720-728(2002).
3. PMID:14573789 "Reduced accumulation of specific microRNAs in colorectal neoplasia" Michael MZ, O' Connor SM, van Holst Pellekaan NG, Young GP, James RJ Mol Cancer Res. 1:882-891(2003).
4. PMID:15325244 "Altered expression profiles of microRNAs during TPA-induced differentiation of HL-60 cells" Kasashima K, Nakamura Y, Kozu T Biochem Biophys Res Commun. 322:403-410(2004).
5. PMID:17604727 "A mammalian microRNA expression atlas based on small RNA library sequencing" Landgraf P, Rusu M, Sheridan R, Sewer A, Iovino N, Aravin A, Pfeffer S, Rice A, Kamphorst AO, Landthaler M, Lin C, Socci ND, Hermida L, Fulci V, Chiaretti S, Foa R, Schliwka J, Fuchs U, Novosel A, Muller RU, Schermer B, Bissels U, Inman J, Phan Q, Chien M Cell. 129:1401-1414(2007).
6. PMID:17616659 "Patterns of known and novel small RNAs in human cervical cancer" Lui WO, Pourmand N, Patterson BK, Fire A Cancer Res. 67:6031-6043(2007).