Stem-loop sequence hsa-mir-26a-1

Accession

MI0000083 (change log)

Previous IDs

hsa-mir-26a

Symbol

HGNC:MIR26A1

Description

Homo sapiens miR-26a-1 stem-loop

Gene family

MIPF0000043; mir-26

Literature search

424 open access papers mention hsa-mir-26a-1
(1747 sentences)

Stem-loop

      g      u         c          --g  ca 
5' gug ccucgu caaguaauc aggauaggcu   ug  g
   ||| |||||| ||||||||| ||||||||||   ||  g
3' cgc ggggca guucauugg ucuuauccgg   ac  u
      a      c         u          gua  cc 

Deep sequencing

13221058 reads, 2.69e+04 reads per million, 159 experiments

Confidence

Annotation confidence: high

Feedback: Do you believe this miRNA is real?

Comments

The mature sequence shown here represents the most commonly cloned form from large-scale cloning studies [6].

Genome context

• Coordinates (GRCh38; GCA_000001405.15): chr3: 37969404-37969480 [+]
• Overlapping transcripts:

  sense

  OTTHUMT00000342399 ; CTDSPL-002; intron 1

  OTTHUMT00000342392 ; CTDSPL-001; intron 1

  OTTHUMT00000342391 ; CTDSPL-003; intron 2

  ENST00000443503 ; CTDSPL-002; intron 1

  ENST00000273179 ; CTDSPL-001; intron 1

  ENST00000435525 ; CTDSPL-003; intron 2

Database links

• EntrezGene:MIR26A1
• HGNC:MIR26A1
• RNAcentral:URS000023C301_9606
• miRBase Tracker:MI0000083

Mature sequence hsa-miR-26a-5p

• Accession: MIMAT0000082
• Previous IDs: hsa-miR-26a
• Sequence: 10 - uucaaguaauccaggauaggcu - 31
• Deep sequencing: 28542742 reads, 159 experiments
• Evidence: experimental; cloned [2,4-7], Northern [3]
• Database links:
  • RNAcentral:URS000019B0F7_9606
• Predicted targets:
  • TargetMiner:hsa-miR-26a-5p
  • TargetScanVert:hsa-miR-26a-5p
  • miRDB:hsa-miR-26a-5p
  • microrna.org:hsa-miR-26a-5p

Mature sequence hsa-miR-26a-1-3p

• Accession: MIMAT0004499
• Previous IDs: hsa-miR-26a-1*
• Sequence: 49 - ccuauucuugguuacuugcacg - 70
• Deep sequencing: 1122 reads, 95 experiments
• Evidence: experimental; cloned [6]
• Database links:
  • RNAcentral:URS00000C0D3F_9606
• Predicted targets:
  • TargetMiner:hsa-miR-26a-1-3p
  • TargetScanVert:hsa-miR-26a-1-3p
  • miRDB:hsa-miR-26a-1-3p
  • microrna.org:hsa-miR-26a-1-3p

References

1. PMID:11679670 "Identification of novel genes coding for small expressed RNAs" Lagos-Quintana M, Rauhut R, Lendeckel W, Tuschl T Science. 294:853-858(2001).
2. PMID:14573789 "Reduced accumulation of specific microRNAs in colorectal neoplasia" Michael MZ, O' Connor SM, van Holst Pellekaan NG, Young GP, James RJ Mol Cancer Res. 1:882-891(2003).
3. PMID:15183728 "Human embryonic stem cells express a unique set of microRNAs" Suh MR, Lee Y, Kim JY, Kim SK, Moon SH, Lee JY, Cha KY, Chung HM, Yoon HS, Moon SY, Kim VN, Kim KS Dev Biol. 270:488-498(2004).
4. PMID:15325244 "Altered expression profiles of microRNAs during TPA-induced differentiation of HL-60 cells" Kasashima K, Nakamura Y, Kozu T Biochem Biophys Res Commun. 322:403-410(2004).
5. PMID:15978578 "Identification of human fetal liver miRNAs by a novel method" Fu H, Tie Y, Xu C, Zhang Z, Zhu J, Shi Y, Jiang H, Sun Z, Zheng X FEBS Lett. 579:3849-3854(2005).
6. PMID:17604727 "A mammalian microRNA expression atlas based on small RNA library sequencing" Landgraf P, Rusu M, Sheridan R, Sewer A, Iovino N, Aravin A, Pfeffer S, Rice A, Kamphorst AO, Landthaler M, Lin C, Socci ND, Hermida L, Fulci V, Chiaretti S, Foa R, Schliwka J, Fuchs U, Novosel A, Muller RU, Schermer B, Bissels U, Inman J, Phan Q, Chien M Cell. 129:1401-1414(2007).
7. PMID:17616659 "Patterns of known and novel small RNAs in human cervical cancer" Lui WO, Pourmand N, Patterson BK, Fire A Cancer Res. 67:6031-6043(2007).