Stem-loop sequence smi-MIR12112

AccessionMI0039714 (change log)
DescriptionSalvia miltiorrhiza miR12112 stem-loop
Literature search

1 open access papers mention smi-MIR12112
(24 sentences)

Stem-loop
   gcggagaccgaca    a  ua         u         a   a  uaagu   a 
5'              gcgg gc  ccaccauug ugguaucaa auc gc     gcu a
                |||| ||  ||||||||| ||||||||| ||| ||     ||| g
3'              cgcc cg  ggugguaac accauaguu uag cg     cga g
   -------------    g  gc         c         c   c  --ugu   a 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Database links

Mature sequence smi-miR12112

Accession MIMAT0049006
Sequence

70 - 

cgaucuugauaccaccaaugg

 - 90

Get sequence
Evidence experimental; Illumina [1]

References

1