Stem-loop sequence csi-MIR169r

AccessionMI0039713 (change log)
DescriptionCitrus sinensis miR169r stem-loop
Literature search

5 open access papers mention csi-MIR169r
(12 sentences)

Stem-loop
   -------   c            -        cggccggaacuagcaaagg 
5'        gug agccaaggauga cuugccgg                   c
          ||| |||||||||||| ||||||||                    
3'        uac ucgguuccuauu gaacggcc                   a
   cucgggu   a            u        uuuuauucccgugaacuua 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Database links

Mature sequence csi-miR169r-5p

Accession MIMAT0049005
Sequence

4 - 

cagccaaggaugacuugccgg

 - 24

Get sequence
Evidence experimental; Illumina [1]

References

1
PMID:28054378 "MicroRNA annotation of plant genomes - Do it right or not at all" Taylor RS, Tarver JE, Foroozani A, Donoghue PC Bioessays. [Epub prior to print](2017).