Stem-loop sequence csi-MIR3951b

AccessionMI0039712 (change log)
DescriptionCitrus sinensis miR3951b stem-loop
Literature search

1 open access papers mention csi-MIR3951b
(3 sentences)

Stem-loop
   -  u            -             -cauc     --a      aau    ucccucuc 
5'  cu ggcacagguaaa gaugagagaaaaa     agaga   gagaga   gugg        u
    || |||||||||||| |||||||||||||     |||||   ||||||   ||||        a
3'  ga ucgugucuauuu cuauucucuuuuu     uuucu   cucucu   uacc        u
   c  u            u             cuucu     uug      gau    cacccacc 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Csi_valencia_1.0; GCA_000317415.1) Overlapping transcripts
chr4: 7871758-7871883 [-]
intergenic
Database links

Mature sequence csi-miR3951b-5p

Accession MIMAT0049003
Sequence

8 - 

cagguaaagaugagagaaaaa

 - 28

Get sequence
Evidence experimental; Illumina [1]

Mature sequence csi-miR3951b-3p

Accession MIMAT0049004
Sequence

99 - 

uuucucuuaucuuuuaucugug

 - 120

Get sequence
Evidence experimental; Illumina [1]

References

1
PMID:28054378 "MicroRNA annotation of plant genomes - Do it right or not at all" Taylor RS, Tarver JE, Foroozani A, Donoghue PC Bioessays. [Epub prior to print](2017).