Stem-loop sequence csi-MIR2111

AccessionMI0039711 (change log)
DescriptionCitrus sinensis miR2111 stem-loop
Stem-loop
   ---------a ug        c          c         u      -     ugu 
5'           u  gugaggau agguaaucug auccugagg uuggau cagca   a
             |  |||||||| |||||||||| ||||||||| |||||| |||||    
3'           a  cauuccua uccauuaggc uaggacucc gaucua guugu   c
   aaaauauaac gu        u          a         u      u     uug 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Csi_valencia_1.0; GCA_000317415.1) Overlapping transcripts
chr6: 8971653-8971760 [-]
intergenic
Database links

Mature sequence csi-miR2111-5p

Accession MIMAT0049002
Sequence

17 - 

uaaucugcauccugagguuug

 - 37

Get sequence
Evidence experimental; Illumina [1]

References

1
PMID:28054378 "MicroRNA annotation of plant genomes - Do it right or not at all" Taylor RS, Tarver JE, Foroozani A, Donoghue PC Bioessays. [Epub prior to print](2017).