Stem-loop sequence csi-MIR169q

AccessionMI0039707 (change log)
DescriptionCitrus sinensis miR169q stem-loop
Literature search

5 open access papers mention csi-MIR169q
(12 sentences)

Stem-loop
   ----   -u       a                -cu   aaaga    uc   caaguuuaacuua 
5'     guu  gauagcc aggaugacuugccuug   ucu     aagg  ucu             g
       |||  ||||||| ||||||||||||||||   |||     ||||  |||              
3'     cag  cuaucgg uucugcugaacgggau   gga     uucc  aga             c
   cgga   uu       g                cuu   -cgug    ua   acgacauguacau 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Csi_valencia_1.0; GCA_000317415.1) Overlapping transcripts
chr6: 14238837-14238963 [-]
intergenic
Database links

Mature sequence csi-miR169q-5p

Accession MIMAT0048997
Sequence

7 - 

uagccaaggaugacuugccu

 - 26

Get sequence
Evidence experimental; Illumina [1]

References

1
PMID:28054378 "MicroRNA annotation of plant genomes - Do it right or not at all" Taylor RS, Tarver JE, Foroozani A, Donoghue PC Bioessays. [Epub prior to print](2017).