Stem-loop sequence csi-MIR169p

AccessionMI0039706 (change log)
DescriptionCitrus sinensis miR169p stem-loop
Literature search

5 open access papers mention csi-MIR169p
(12 sentences)

Stem-loop
   a     -----g   c   g  u  c      cau   u  u  -au  u    caaa     u 
5'  guuug      uag caa ga ga uugccu   cug cc ca   gg cuuu    aaaug u
    |||||      ||| ||| || || ||||||   ||| || ||   || ||||    ||||| g
3'  cagac      auc guu cu cu aacgga   gau gg gu   cc gaaa    uuuac a
   -     aguuua   a   a  -  -      --c   -  u  guu  c    --ua     a 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Csi_valencia_1.0; GCA_000317415.1) Overlapping transcripts
chr2: 10984178-10984294 [+]
intergenic
Clustered miRNAs
< 10kb from csi-MIR169p
csi-MIR169pchr2: 10984178-10984294 [+]
csi-MIR169cchr2: 10985954-10986108 [+]
Database links

Mature sequence csi-miR169p-5p

Accession MIMAT0048996
Sequence

8 - 

uagccaaggaugacuugccu

 - 27

Get sequence
Evidence experimental; Illumina [1]

References

1
PMID:28054378 "MicroRNA annotation of plant genomes - Do it right or not at all" Taylor RS, Tarver JE, Foroozani A, Donoghue PC Bioessays. [Epub prior to print](2017).