Stem-loop sequence csi-MIR169o

AccessionMI0039705 (change log)
DescriptionCitrus sinensis miR169o stem-loop
Literature search

5 open access papers mention csi-MIR169o
(12 sentences)

Stem-loop
   -------   c            -        cggccggaacuagcaaagg 
5'        gug agccaaggauga cuugccgg                   c
          ||| |||||||||||| ||||||||                    
3'        uac ucgguuccuauu gaacggcc                   a
   cucgggu   a            u        uuuuauucccgugaacuua 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Csi_valencia_1.0; GCA_000317415.1) Overlapping transcripts
chr7: 4557214-4557309 [-]
intergenic
Clustered miRNAs
< 10kb from csi-MIR169o
csi-MIR169ochr7: 4557214-4557309 [-]
csi-MIR169nchr7: 4557016-4557094 [-]
Database links

Mature sequence csi-miR169o-5p

Accession MIMAT0048995
Sequence

4 - 

cagccaaggaugacuugccgg

 - 24

Get sequence
Evidence experimental; Illumina [1]

References

1
PMID:28054378 "MicroRNA annotation of plant genomes - Do it right or not at all" Taylor RS, Tarver JE, Foroozani A, Donoghue PC Bioessays. [Epub prior to print](2017).