Stem-loop sequence csi-MIR156j

AccessionMI0039703 (change log)
DescriptionCitrus sinensis miR156j stem-loop
Literature search

7 open access papers mention csi-MIR156j
(36 sentences)

Stem-loop
   gugaaa      c  u     g   ac       u   ag   u     a   aaaa 
5'       ggcuga ac cagcu cug  ucguugg uca  agc cauca ugg    u
         |||||| || ||||| |||  ||||||| |||  ||| ||||| |||    g
3'       cugauu ug gucga gac  agcaacc agu  uug guagu acu    u
   ---gua      -  c     g   ga       u   cu   u     -   aaga 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Csi_valencia_1.0; GCA_000317415.1) Overlapping transcripts
chr2: 10333819-10333930 [+]
intergenic
Database links

Mature sequence csi-miR156j-5p

Accession MIMAT0048991
Sequence

18 - 

agcugcugacucguugguuca

 - 38

Get sequence
Evidence experimental; Illumina [1]

Mature sequence csi-miR156j-3p

Accession MIMAT0048992
Sequence

81 - 

auccaacgaagcaggagcugc

 - 101

Get sequence
Evidence experimental; Illumina [1]

References

1
PMID:28054378 "MicroRNA annotation of plant genomes - Do it right or not at all" Taylor RS, Tarver JE, Foroozani A, Donoghue PC Bioessays. [Epub prior to print](2017).