Stem-loop sequence csi-MIR156i

AccessionMI0039702 (change log)
DescriptionCitrus sinensis miR156i stem-loop
Literature search

7 open access papers mention csi-MIR156i
(36 sentences)

Stem-loop
   gaaauu   u    a   g     u   a  -uaaa         cauua 
5'       uug ugac gaa auaga agc ca     uuaaaaugc     a
         ||| |||| ||| ||||| ||| ||     |||||||||      
3'       aac acug cuu ugucu ucg gu     aauuuuacg     u
   acgugc   u    c   a     c   a  uucua         caaac 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Csi_valencia_1.0; GCA_000317415.1) Overlapping transcripts
chr2: 10067141-10067241 [+]
intergenic
Database links

Mature sequence csi-miR156i-5p

Accession MIMAT0048990
Sequence

10 - 

uugacagaagauagauagcac

 - 30

Get sequence
Evidence experimental; Illumina [1]

References

1
PMID:28054378 "MicroRNA annotation of plant genomes - Do it right or not at all" Taylor RS, Tarver JE, Foroozani A, Donoghue PC Bioessays. [Epub prior to print](2017).