Stem-loop sequence csi-MIR156h

AccessionMI0039701 (change log)
DescriptionCitrus sinensis miR156h stem-loop
Literature search

7 open access papers mention csi-MIR156h
(37 sentences)

Stem-loop
   gaacuu   u        g       a    -uaaa         cauua 
5'       uug ugacagaa auagaga caca     uuaaaaugc     a
         ||| |||||||| ||||||| ||||     |||||||||      
3'       aac acugucuu uaucucu gugu     aauuuuacg     u
   acgugc   u        a       c    uucua         caaac 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Csi_valencia_1.0; GCA_000317415.1) Overlapping transcripts
chr2: 10039848-10039948 [+]
intergenic
Database links

Mature sequence csi-miR156h-5p

Accession MIMAT0048989
Sequence

13 - 

acagaagauagagaacacaua

 - 33

Get sequence
Evidence experimental; Illumina [1]

References

1
PMID:28054378 "MicroRNA annotation of plant genomes - Do it right or not at all" Taylor RS, Tarver JE, Foroozani A, Donoghue PC Bioessays. [Epub prior to print](2017).