Stem-loop sequence csi-MIR482g

AccessionMI0039700 (change log)
DescriptionCitrus sinensis miR482g stem-loop
Literature search

4 open access papers mention csi-MIR482g
(6 sentences)

Stem-loop
   a       u            -       u       -   gaaaacguauaauuuuucuuuucu 
5'  ggaaguu ugggagugggag cgugggg aagaagu gaa                        u
    ||||||| |||||||||||| ||||||| ||||||| |||                        u
3'  ccuuuag auccuuacccuc guauccc uucuuua cuu                        u
   -       u            c       -       a   aaacauuaaaagaaagaguuaacu 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Csi_valencia_1.0; GCA_000317415.1) Overlapping transcripts
chr2: 9942925-9943053 [+]
intergenic
Clustered miRNAs
< 10kb from csi-MIR482g
csi-MIR482achr2: 9941395-9941523 [+]
csi-MIR482gchr2: 9942925-9943053 [+]
Database links

Mature sequence csi-miR482g-5p

Accession MIMAT0048987
Sequence

14 - 

agugggagcgugggguaagaag

 - 35

Get sequence
Evidence experimental; Illumina [1]

Mature sequence csi-miR482g-3p

Accession MIMAT0048988
Sequence

98 - 

ucuucccuaugccucccauucc

 - 119

Get sequence
Evidence experimental; Illumina [1]

References

1
PMID:28054378 "MicroRNA annotation of plant genomes - Do it right or not at all" Taylor RS, Tarver JE, Foroozani A, Donoghue PC Bioessays. [Epub prior to print](2017).