Stem-loop sequence csi-MIR168

Accession

MI0039699 (change log)

Description

Citrus sinensis miR168 stem-loop

Literature search

2 open access papers mention csi-MIR168
(5 sentences)

Stem-loop

   g     gg       ua     c          u     a ug   g  ua        uuugaaauuuuuugacagcgagguggcgug 
5'  uuacc  cggucuc  auucg uuggugcagg cggga c  auu gc  guuuuuuu                              u
    |||||  |||||||  ||||| |||||||||| ||||| |  ||| ||  ||||||||                              u
3'  agugg  gccagag  uaagu aacuacguuc gcccu g  uaa cg  uaaaaaag                              g
   -     -a       gc     c          c     a gu   g  --        uuaguaauuaaauuugcaaugcugguuaau 

Confidence

Annotation confidence: not enough data

Feedback: Do you believe this miRNA is real?

Genome context

• Coordinates (Csi_valencia_1.0; GCA_000317415.1): JH999176.1: 244098-244274 [+]
• Overlapping transcripts:

  intergenic

Database links

• miRBase Tracker:MI0039699

Mature sequence csi-miR168-5p

• Accession: MIMAT0048985
• Sequence: 20 - ucgcuuggugcaggucgggaa - 40
• Evidence: experimental; Illumina [1]

Mature sequence csi-miR168-3p

• Accession: MIMAT0048986
• Sequence: 142 - cccgccuugcaucaacugaau - 162
• Evidence: experimental; Illumina [1]

References

1. PMID:28054378 "MicroRNA annotation of plant genomes - Do it right or not at all" Taylor RS, Tarver JE, Foroozani A, Donoghue PC Bioessays. [Epub prior to print](2017).