Stem-loop sequence csi-MIR168

AccessionMI0039699 (change log)
DescriptionCitrus sinensis miR168 stem-loop
Literature search

2 open access papers mention csi-MIR168
(5 sentences)

Stem-loop
   g     gg       ua     c          u     a ug   g  ua        uuugaaauuuuuugacagcgagguggcgug 
5'  uuacc  cggucuc  auucg uuggugcagg cggga c  auu gc  guuuuuuu                              u
    |||||  |||||||  ||||| |||||||||| ||||| |  ||| ||  ||||||||                              u
3'  agugg  gccagag  uaagu aacuacguuc gcccu g  uaa cg  uaaaaaag                              g
   -     -a       gc     c          c     a gu   g  --        uuaguaauuaaauuugcaaugcugguuaau 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Csi_valencia_1.0; GCA_000317415.1) Overlapping transcripts
JH999176.1: 244098-244274 [+]
intergenic
Database links

Mature sequence csi-miR168-5p

Accession MIMAT0048985
Sequence

20 - 

ucgcuuggugcaggucgggaa

 - 40

Get sequence
Evidence experimental; Illumina [1]

Mature sequence csi-miR168-3p

Accession MIMAT0048986
Sequence

142 - 

cccgccuugcaucaacugaau

 - 162

Get sequence
Evidence experimental; Illumina [1]

References

1
PMID:28054378 "MicroRNA annotation of plant genomes - Do it right or not at all" Taylor RS, Tarver JE, Foroozani A, Donoghue PC Bioessays. [Epub prior to print](2017).