Stem-loop sequence csi-MIR12111

AccessionMI0039698 (change log)
DescriptionCitrus sinensis miR12111 stem-loop
Stem-loop
   ucucuuaaacacaugga                          g g         a  auaau  aaaaac    uug 
5'                  agagagaaaaacuuaggugggauagu u accacguca uc     gg      uagg   u
                    |||||||||||||||||||||||||| | ||||||||| ||     ||      ||||   u
3'                  uuucucuuuuugaaucuacccuguca g uggugcagu ag     cc      aucc   c
   -------acuaggaaga                          g g         -  cacau  -guauc    uau 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Csi_valencia_1.0; GCA_000317415.1) Overlapping transcripts
chr5: 8697594-8697743 [-]
intergenic
Database links

Mature sequence csi-miR12111-5p

Accession MIMAT0048983
Sequence

23 - 

gaaaaacuuaggugggauagugug

 - 46

Get sequence
Evidence experimental; Illumina [1]

Mature sequence csi-miR12111-3p

Accession MIMAT0048984
Sequence

114 - 

gacugucccaucuaaguuuuucuc

 - 137

Get sequence
Evidence experimental; Illumina [1]

References

1
PMID:28054378 "MicroRNA annotation of plant genomes - Do it right or not at all" Taylor RS, Tarver JE, Foroozani A, Donoghue PC Bioessays. [Epub prior to print](2017).