Stem-loop sequence csi-MIR12110

AccessionMI0039697 (change log)
DescriptionCitrus sinensis miR12110 stem-loop
Stem-loop
   -         a u  ug        -c  c   a    -uuucuuca   uc 
5'  gagauagau g uc  gggaguug  ac cgg guaa         gcu  u
    ||||||||| | ||  ||||||||  || ||| ||||         |||  u
3'  cucuaucua c ag  cccucgac  ug gcc cauu         cga  u
   a         g c  gu        ac  a   c    uauauuuug   uu 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Csi_valencia_1.0; GCA_000317415.1) Overlapping transcripts
chr9: 17616672-17616775 [-]
intergenic
Database links

Mature sequence csi-miR12110-5p

Accession MIMAT0048981
Sequence

14 - 

cuggggaguugcacccggagu

 - 34

Get sequence
Evidence experimental; Illumina [1]

Mature sequence csi-miR12110-3p

Accession MIMAT0048982
Sequence

71 - 

cccgagucacagcucccuggac

 - 92

Get sequence
Evidence experimental; Illumina [1]

References

1
PMID:28054378 "MicroRNA annotation of plant genomes - Do it right or not at all" Taylor RS, Tarver JE, Foroozani A, Donoghue PC Bioessays. [Epub prior to print](2017).