Stem-loop sequence csi-MIR9560

AccessionMI0039696 (change log)
DescriptionCitrus sinensis miR9560 stem-loop
Stem-loop
   -----c     g   uuc     g      a      a          a   u 
5'       aaggu uga   ugaau cacagg ggugga caaauaugaa uuu c
         ||||| |||   ||||| |||||| |||||| |||||||||| ||| a
3'       uuccg acu   acuua gugucc ccaccu guuuauacuu aag u
   uagaga     -   uaa     g      a      c          a   u 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Csi_valencia_1.0; GCA_000317415.1) Overlapping transcripts
chr3: 18990552-18990654 [-]
intergenic
Database links

Mature sequence csi-miR9560-5p

Accession MIMAT0048979
Sequence

21 - 

acaggagguggaacaaauaugaaa

 - 44

Get sequence
Evidence experimental; Illumina [1]

Mature sequence csi-miR9560-3p

Accession MIMAT0048980
Sequence

58 - 

ucauauuugcuccaccaccugugg

 - 81

Get sequence
Evidence experimental; Illumina [1]

References

1
PMID:28054378 "MicroRNA annotation of plant genomes - Do it right or not at all" Taylor RS, Tarver JE, Foroozani A, Donoghue PC Bioessays. [Epub prior to print](2017).