Stem-loop sequence csi-MIR12108

AccessionMI0039694 (change log)
DescriptionCitrus sinensis miR12108 stem-loop
Stem-loop
   -u              gg     cau                u               ----uu       -uucau          ucaaauuuaa 
5'   aaauauauauguaa  auucu   gugcagacguucgcac uuuuaaaaugcagau      auguuag      gcuaauuagc          c
     ||||||||||||||  |||||   |||||||||||||||| |||||||||||||||      |||||||      ||||||||||          a
3'   uuuguauauauauu  uaaga   cacgucuguaggcgug aaaauuuuacgucua      uacaauu      cgauuaauug          u
   uc              ag     aau                c               uacuuu       gaaacu          uacuuauucu 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Csi_valencia_1.0; GCA_000317415.1) Overlapping transcripts
JH999167.1: 85093-85283 [+]
intergenic
Database links

Mature sequence csi-miR12108-5p

Accession MIMAT0048975
Sequence

30 - 

agacguucgcacuuuuuaaaaugc

 - 53

Get sequence
Evidence experimental; Illumina [1]

Mature sequence csi-miR12108-3p

Accession MIMAT0048976
Sequence

140 - 

auuuuaaaacgugcggaugucugc

 - 163

Get sequence
Evidence experimental; Illumina [1]

References

1
PMID:28054378 "MicroRNA annotation of plant genomes - Do it right or not at all" Taylor RS, Tarver JE, Foroozani A, Donoghue PC Bioessays. [Epub prior to print](2017).