Stem-loop sequence csi-MIR482e

AccessionMI0039692 (change log)
DescriptionCitrus sinensis miR482e stem-loop
Literature search

4 open access papers mention csi-MIR482e
(6 sentences)

Stem-loop
   ---        c       c      c   u    u          -        aaaaucuuucaauuuuaccauaaaguau 
5'    ggaaaggg ugaggcc guaaga auu ucgg caugggagga uuggcgaa                            a
      |||||||| ||||||| |||||| ||| |||| |||||||||| ||||||||                            u
3'    ccuuucuu acuuugg uauucu uag agcc guacccuccu aaccguuu                            a
   uaa        a       -      u   u    -          c        ucuaaaguaaauuaguaguagcaguaga 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Csi_valencia_1.0; GCA_000317415.1) Overlapping transcripts
chr2: 9926991-9927153 [+]
intergenic
Clustered miRNAs
< 10kb from csi-MIR482e
csi-MIR482echr2: 9926991-9927153 [+]
csi-MIR482cchr2: 9927230-9927325 [+]
csi-MIR482bchr2: 9932506-9932614 [+]
Database links

Mature sequence csi-miR482e-5p

Accession MIMAT0048973
Sequence

31 - 

ggucaugggaggauuggcga

 - 50

Get sequence
Evidence experimental; Illumina [1]

Mature sequence csi-miR482e-3p

Accession MIMAT0048974
Sequence

112 - 

uugccaacuccucccaugccga

 - 133

Get sequence
Evidence experimental; Illumina [1]

References

1
PMID:28054378 "MicroRNA annotation of plant genomes - Do it right or not at all" Taylor RS, Tarver JE, Foroozani A, Donoghue PC Bioessays. [Epub prior to print](2017).