Stem-loop sequence csi-MIR12107

AccessionMI0039690 (change log)
DescriptionCitrus sinensis miR12107 stem-loop
Stem-loop
   -caagua     -uau      a      u  c         a            ccuuaaaucuuucucaauuuauaaa 
5'        aaauu    uuugag guguuu ua ugaugagag gcgaaugauaaa                         c
          |||||    |||||| |||||| || ||||||||| ||||||||||||                         a
3'        uuuag    aaacuu cgcaag au acuacucuc cgcuuacuauuu                         a
   aauaaac     uccu      c      u  u         g            aaacuaaaaaaaaccuuagaggguu 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Csi_valencia_1.0; GCA_000317415.1) Overlapping transcripts
chr4: 1005818-1005978 [+]
intergenic
Database links

Mature sequence csi-miR12107-5p

Accession MIMAT0048971
Sequence

31 - 

cugaugagagagcgaaugaua

 - 51

Get sequence
Evidence experimental; Illumina [1]

Mature sequence csi-miR12107-3p

Accession MIMAT0048972
Sequence

111 - 

ucauucgcgcucucaucauua

 - 131

Get sequence
Evidence experimental; Illumina [1]

References

1
PMID:28054378 "MicroRNA annotation of plant genomes - Do it right or not at all" Taylor RS, Tarver JE, Foroozani A, Donoghue PC Bioessays. [Epub prior to print](2017).