Stem-loop sequence csi-MIR536

AccessionMI0039688 (change log)
DescriptionCitrus sinensis miR536 stem-loop
Stem-loop
   ----  ga   uaugau         g   -         cc        a       aaa     ga ua 
5'     gu  agu      aagaguaag auu gaggcgcac  cagcgugg accauca   guugu  u  c
       ||  |||      ||||||||| ||| |||||||||  |||||||| |||||||   |||||  |  a
3'     ca  ucg      uucuuauuc uaa uucugcgug  gucgcacc ugguagu   uaacg  a  g
   cgaa  ga   ---cgu         g   g         -u        g       ggg     ag uu 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Csi_valencia_1.0; GCA_000317415.1) Overlapping transcripts
chr7: 1201524-1201659 [-]
intergenic
Database links

Mature sequence csi-miR536-5p

Accession MIMAT0048967
Sequence

31 - 

cgcaccccagcguggaaccauc

 - 52

Get sequence
Evidence experimental; Illumina [1]

Mature sequence csi-miR536-3p

Accession MIMAT0048968
Sequence

86 - 

uggugccacgcugugugcguc

 - 106

Get sequence
Evidence experimental; Illumina [1]

References

1
PMID:28054378 "MicroRNA annotation of plant genomes - Do it right or not at all" Taylor RS, Tarver JE, Foroozani A, Donoghue PC Bioessays. [Epub prior to print](2017).