Stem-loop sequence csi-MIR3954b

AccessionMI0039686 (change log)
DescriptionCitrus sinensis miR3954b stem-loop
Stem-loop
   uauuauuuugcuuugguuuggucuguuuacaaagugagaaaaucacuuucguuguucguuguuagaaaaaaauau      u        u    a        u      cau    u      -  --    cug      aau   u 
5'                                                                            gaucaa uauauuug uugg cagagaaa cacggu   gaga gaguuu uc  uaau   uacugu   cug a
                                                                              |||||| |||||||| |||| |||||||| ||||||   |||| |||||| ||  ||||   ||||||   |||  
3'                                                                            cuaguu auauagac aacc gucucuuu gugcca   uucu cuuagg ag  guua   guggua   ggc u
   -----------------------------------------------------------ugucuuuaccuuacuu      u        u    c        -      ucu    -      u  ca    uaa      -gu   a 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Csi_valencia_1.0; GCA_000317415.1) Overlapping transcripts
chr9: 5824724-5824960 [-]
intergenic
Database links

Mature sequence csi-miR3954b-5p

Accession MIMAT0048963
Sequence

92 - 

uuggacagagaaaucacgguca

 - 113

Get sequence
Evidence experimental; Illumina [1]

Mature sequence csi-miR3954b-3p

Accession MIMAT0048964
Sequence

187 - 

accguguuucucugcccaauc

 - 207

Get sequence
Evidence experimental; Illumina [1]

References

1
PMID:28054378 "MicroRNA annotation of plant genomes - Do it right or not at all" Taylor RS, Tarver JE, Foroozani A, Donoghue PC Bioessays. [Epub prior to print](2017).