Stem-loop sequence csi-MIR3627c

AccessionMI0039682 (change log)
DescriptionCitrus sinensis miR3627c stem-loop
Stem-loop
   aauuaaauau  a         --ca               a     g   aa    a   g 
5'           ag aaguugggg    cuuauaucgcagggg gaugg acc  cugc gcc c
             || |||||||||    ||||||||||||||| ||||| |||  |||| |||  
3'           uc uucaaccuc    gaguauagcguccuc cuacc ugg  gacg ugg u
   aaaccuguuc  a         ccaa               -     g   cc    a   a 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Csi_valencia_1.0; GCA_000317415.1) Overlapping transcripts
chr6: 19939025-19939147 [+]
intergenic
Clustered miRNAs
< 10kb from csi-MIR3627c
csi-MIR3627cchr6: 19939025-19939147 [+]
csi-MIR3627achr6: 19940722-19940874 [-]
csi-MIR3627bchr6: 19944464-19944728 [+]
Database links

Mature sequence csi-miR3627c-5p

Accession MIMAT0048956
Sequence

31 - 

ucgcaggggagaugggaccaac

 - 52

Get sequence
Evidence experimental; Illumina [1]

References

1
PMID:28054378 "MicroRNA annotation of plant genomes - Do it right or not at all" Taylor RS, Tarver JE, Foroozani A, Donoghue PC Bioessays. [Epub prior to print](2017).