Stem-loop sequence csi-MIR3627b

AccessionMI0039681 (change log)
DescriptionCitrus sinensis miR3627b stem-loop
Stem-loop
   gggucauaagcaggagacauacgcaacaacgacagagcuuaauuagcacaaaagugaggaaaaauuauaaaggaaaguaaucgaagccaagccaaggccugcaugaauuuuaaggcaagcacaugcuagaaaaagaaauuaa        ca      -            gc        c   -  cg     cgu 
5'                                                                                                                                               aagaaguu  ggggcu cuugucgcagga  guuggcac ugc ac  gccac   g
                                                                                                                                                 ||||||||  |||||| ||||||||||||  |||||||| ||| ||  |||||   u
3'                                                                                                                                               uucuucaa  ucccga gaacaguguccu  cgaccgug acg ug  uggug   g
   ---------------------------------------------------------------------------------------------------------------------------------uuuuuacacucgc        aa      a            -a        a   c  --     uau 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Csi_valencia_1.0; GCA_000317415.1) Overlapping transcripts
chr6: 19944464-19944728 [+]
intergenic
Clustered miRNAs
< 10kb from csi-MIR3627b
csi-MIR3627cchr6: 19939025-19939147 [+]
csi-MIR3627achr6: 19940722-19940874 [-]
csi-MIR3627bchr6: 19944464-19944728 [+]
Database links

Mature sequence csi-miR3627b-3p

Accession MIMAT0048955
Sequence

160 - 

uugucgcaggagcguuggcacc

 - 181

Get sequence
Evidence experimental; Illumina [1]

References

1
PMID:28054378 "MicroRNA annotation of plant genomes - Do it right or not at all" Taylor RS, Tarver JE, Foroozani A, Donoghue PC Bioessays. [Epub prior to print](2017).