Stem-loop sequence csi-MIR3627a

AccessionMI0039680 (change log)
DescriptionCitrus sinensis miR3627a stem-loop
Stem-loop
   ------gcaggagag     gg  cuac     u            a     a  a c   uaccucuuaau     u     
5'                agagg  gg    aggga ucuugucgccgg gagau gc c uac           ugcau aacu 
                  |||||  ||    ||||| |||||||||||| ||||| || | |||           ||||| ||| a
3'                ucucc  cu    ucccu agaacaguggcc cucua cg g aug           acgug uuga 
   aacuauauauauaua     ua  ----     c            -     c  c a   ccgcaauaaau     -     
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Csi_valencia_1.0; GCA_000317415.1) Overlapping transcripts
chr6: 19940722-19940874 [-]
intergenic
Clustered miRNAs
< 10kb from csi-MIR3627a
csi-MIR3627bchr6: 19944464-19944728 [+]
csi-MIR3627achr6: 19940722-19940874 [-]
csi-MIR3627cchr6: 19939025-19939147 [+]
Database links

Mature sequence csi-miR3627a-5p

Accession MIMAT0048954
Sequence

31 - 

uugucgccggagagauagcacc

 - 52

Get sequence
Evidence experimental; Illumina [1]

References

1
PMID:28054378 "MicroRNA annotation of plant genomes - Do it right or not at all" Taylor RS, Tarver JE, Foroozani A, Donoghue PC Bioessays. [Epub prior to print](2017).