Stem-loop sequence csi-MIR2275b

AccessionMI0039679 (change log)
DescriptionCitrus sinensis miR2275b stem-loop
Stem-loop
   --------------------   u    --auuu       ----a       ----------------      -      u             uuaacuacuaaauagu 
5'                     cca uugc      cuuuauu     guuguau                guaaga auugga ggaacuaaacaga                a
                       ||| ||||      |||||||     |||||||                |||||| |||||| |||||||||||||                a
3'                     ggu aaug      gaaauaa     caacaua                uauucu uaaccu cuuugauuugucu                g
   cuguacagacaaaaccagga   u    aaucuu       aaacg       ucaaaucuucaaccuc      a      c             uuuucuuauaaagcua 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Csi_valencia_1.0; GCA_000317415.1) Overlapping transcripts
JH999163.1: 326415-326598 [+]
intergenic
Database links

Mature sequence csi-miR2275b-5p

Accession MIMAT0048952
Sequence

31 - 

agaauuggauggaacuaaaca

 - 51

Get sequence
Evidence experimental; Illumina [1]

Mature sequence csi-miR2275b-3p

Accession MIMAT0048953
Sequence

93 - 

uuuaguuuccuccaauaucuua

 - 114

Get sequence
Evidence experimental; Illumina [1]

References

1
PMID:28054378 "MicroRNA annotation of plant genomes - Do it right or not at all" Taylor RS, Tarver JE, Foroozani A, Donoghue PC Bioessays. [Epub prior to print](2017).