Stem-loop sequence csi-MIR2275a

AccessionMI0039678 (change log)
DescriptionCitrus sinensis miR2275a stem-loop
Stem-loop
   --cccuucauuugca   cu      uau      -      u            auuaguaag  c 
5'                uuu  aaguug   guaaga auugga ggaacuaaacag         au a
                  |||  ||||||   |||||| |||||| ||||||||||||         ||  
3'                aaa  uucgac   uauucu uaaccu cuuugauuuguc         ua a
   ccaaauauauauauc   uc      cuc      a      c            guugacuua  a 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Csi_valencia_1.0; GCA_000317415.1) Overlapping transcripts
chr6: 20307148-20307280 [+]
intergenic
Database links

Mature sequence csi-miR2275a-5p

Accession MIMAT0048950
Sequence

31 - 

agaauuggauggaacuaaaca

 - 51

Get sequence
Evidence experimental; Illumina [1]

Mature sequence csi-miR2275a-3p

Accession MIMAT0048951
Sequence

82 - 

uuuaguuuccuccaauaucuua

 - 103

Get sequence
Evidence experimental; Illumina [1]

References

1
PMID:28054378 "MicroRNA annotation of plant genomes - Do it right or not at all" Taylor RS, Tarver JE, Foroozani A, Donoghue PC Bioessays. [Epub prior to print](2017).