Stem-loop sequence csi-MIR858

AccessionMI0039677 (change log)
DescriptionCitrus sinensis miR858 stem-loop
Stem-loop
   gc    cu   -    --       u uuuu     u  a 
5'   uaug  ugu caag  ugagcag c    gcgag ua c
     ||||  ||| ||||  ||||||| |    ||||| || c
3'   auac  aca guuc  gcuuguc g    ugcuc gu u
   gu    au   a    ca       u ---u     c  u 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Csi_valencia_1.0; GCA_000317415.1) Overlapping transcripts
chr2: 13416109-13416185 [+]
intergenic
Database links

Mature sequence csi-miR858-3p

Accession MIMAT0048949
Sequence

45 - 

cucguugucuguucgaccuug

 - 65

Get sequence
Evidence experimental; Illumina [1]

References

1
PMID:28054378 "MicroRNA annotation of plant genomes - Do it right or not at all" Taylor RS, Tarver JE, Foroozani A, Donoghue PC Bioessays. [Epub prior to print](2017).