Stem-loop sequence csi-MIR535b

AccessionMI0039675 (change log)
DescriptionCitrus sinensis miR535b stem-loop
Literature search

2 open access papers mention csi-MIR535b
(5 sentences)

Stem-loop
   ---auccuugcccagacucaauac      gcu        ag         a cu  ---    auucg   a 
5'                         aaauuu   ugacaaug  agagagcac c  gu   cagc     ugc a
                           ||||||   ||||||||  ||||||||| |  ||   ||||     ||| a
3'                         uuuaaa   acuguuac  ucucucgug g  ca   gucg     acg u
   ucuguuauaaguugacgaaauucg      -au        ca         c au  ucu    ---ga   g 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Csi_valencia_1.0; GCA_000317415.1) Overlapping transcripts
chr2: 14795671-14795811 [-]
intergenic
Database links

Mature sequence csi-miR535b-5p

Accession MIMAT0048945
Sequence

31 - 

ugacaaugagagagagcacac

 - 51

Get sequence
Evidence experimental; Illumina [1]

Mature sequence csi-miR535b-3p

Accession MIMAT0048946
Sequence

91 - 

gugcucucuaccauugucaua

 - 111

Get sequence
Evidence experimental; Illumina [1]

References

1
PMID:28054378 "MicroRNA annotation of plant genomes - Do it right or not at all" Taylor RS, Tarver JE, Foroozani A, Donoghue PC Bioessays. [Epub prior to print](2017).