Stem-loop sequence csi-MIR482d

AccessionMI0039674 (change log)
DescriptionCitrus sinensis miR482d stem-loop
Literature search

4 open access papers mention csi-MIR482d
(6 sentences)

Stem-loop
   -------        uugaa     u       g  u           -             -----    aac       -  a     ucacu 
5'        agagggag     ggaua ugggaag uu ugguaugggug aguagggaagaua     auuu   uaaguaa ua uaaua     u
          ||||||||     ||||| ||||||| || ||||||||||| |||||||||||||     ||||   ||||||| || |||||     u
3'        ucucccuc     cuuau acccuuu ga accguacccac ucaucccuucuau     uaag   auucauu au auuau     u
   cuauucc        -----     u       g  u           c             auguu    -ga       u  c     uacuu 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Csi_valencia_1.0; GCA_000317415.1) Overlapping transcripts
chr6: 1186417-1186589 [+]
intergenic
Database links

Mature sequence csi-miR482d-5p

Accession MIMAT0048943
Sequence

31 - 

ugguaugggugaguagggaag

 - 51

Get sequence
Evidence experimental; Illumina [1]

Mature sequence csi-miR482d-3p

Accession MIMAT0048944
Sequence

122 - 

ucccuacuccacccaugccaua

 - 143

Get sequence
Evidence experimental; Illumina [1]

References

1
PMID:28054378 "MicroRNA annotation of plant genomes - Do it right or not at all" Taylor RS, Tarver JE, Foroozani A, Donoghue PC Bioessays. [Epub prior to print](2017).