Stem-loop sequence csi-MIR477e

AccessionMI0039673 (change log)
DescriptionCitrus sinensis miR477e stem-loop
Literature search

1 open access papers mention csi-MIR477e
(3 sentences)

Stem-loop
   ---    -  c        u          ugaacu      guucac 
5'    auug cu acucuccc caagggcuuc      ggccuu      c
      |||| || |||||||| ||||||||||      ||||||      u
3'    uaau ga ugagaggg guucuuggag      ccggaa      u
   uug    a  -        -          ucagau      auuaac 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Csi_valencia_1.0; GCA_000317415.1) Overlapping transcripts
chr5: 1063882-1063974 [-]
intergenic
Clustered miRNAs
< 10kb from csi-MIR477e
csi-MIR477dchr5: 1064087-1064188 [-]
csi-MIR477echr5: 1063882-1063974 [-]
Database links

Mature sequence csi-miR477e-5p

Accession MIMAT0048941
Sequence

8 - 

acucucccucaagggcuucuga

 - 29

Get sequence
Evidence experimental; Illumina [1]

Mature sequence csi-miR477e-3p

Accession MIMAT0048942
Sequence

65 - 

ugagguucuuggggagaguag

 - 85

Get sequence
Evidence experimental; Illumina [1]

References

1
PMID:28054378 "MicroRNA annotation of plant genomes - Do it right or not at all" Taylor RS, Tarver JE, Foroozani A, Donoghue PC Bioessays. [Epub prior to print](2017).