Stem-loop sequence csi-MIR477d

AccessionMI0039672 (change log)
DescriptionCitrus sinensis miR477d stem-loop
Literature search

2 open access papers mention csi-MIR477d
(11 sentences)

Stem-loop
   ---   cu         u   g      u   guuaauuaaugacaauuauu 
5'    uug  cacucuccc caa ggcuuc ggc                    a
      |||  ||||||||| ||| |||||| |||                     
3'    aac  gugagaggg guu ccggag ccg                    a
   gaa   ag         -   g      u   gaccguccgucgacguucgu 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Csi_valencia_1.0; GCA_000317415.1) Overlapping transcripts
chr5: 1064087-1064188 [-]
intergenic
Clustered miRNAs
< 10kb from csi-MIR477d
csi-MIR477dchr5: 1064087-1064188 [-]
csi-MIR477echr5: 1063882-1063974 [-]
Database links

Mature sequence csi-miR477d-5p

Accession MIMAT0048939
Sequence

7 - 

acucucccucaagggcuucugg

 - 28

Get sequence
Evidence experimental; Illumina [1]

Mature sequence csi-miR477d-3p

Accession MIMAT0048940
Sequence

75 - 

ugaggccguuggggagagugg

 - 95

Get sequence
Evidence experimental; Illumina [1]

References

1
PMID:28054378 "MicroRNA annotation of plant genomes - Do it right or not at all" Taylor RS, Tarver JE, Foroozani A, Donoghue PC Bioessays. [Epub prior to print](2017).