Stem-loop sequence csi-MIR399f

AccessionMI0039670 (change log)
DescriptionCitrus sinensis miR399f stem-loop
Literature search

4 open access papers mention csi-MIR399f
(12 sentences)

Stem-loop
   uuc    g  cgcg     -  ga    uc                    a a       gcgcuuguacguacacgcacggugc 
5'    ugcg gc    gguag ag  gaau  cagggcaauucuccuuuggc g aaauauu                         a
      |||| ||    ||||| ||  ||||  |||||||||||||||||||| | |||||||                          
3'    acgu ug    ccauc uc  cuua  gucccguuaagaggaaaccg c uuuauaa                         g
   cau    a  uaua     a  aa    cc                    c g       uauauaauaucguggacacguucau 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Csi_valencia_1.0; GCA_000317415.1) Overlapping transcripts
chr2: 2298474-2298644 [-]
intergenic
Clustered miRNAs
< 10kb from csi-MIR399f
csi-MIR399echr2: 2305516-2305646 [+]
csi-MIR399cchr2: 2303898-2304046 [-]
csi-MIR399fchr2: 2298474-2298644 [-]
csi-MIR399achr2: 2292782-2292936 [+]
Database links

Mature sequence csi-miR399f-5p

Accession MIMAT0048935
Sequence

32 - 

gggcaauucuccuuuggcaga

 - 52

Get sequence
Evidence experimental; Illumina [1]

Mature sequence csi-miR399f-3p

Accession MIMAT0048936
Sequence

121 - 

cgccaaaggagaauugcccug

 - 141

Get sequence
Evidence experimental; Illumina [1]

References

1
PMID:28054378 "MicroRNA annotation of plant genomes - Do it right or not at all" Taylor RS, Tarver JE, Foroozani A, Donoghue PC Bioessays. [Epub prior to print](2017).