Stem-loop sequence csi-MIR399e

AccessionMI0039669 (change log)
DescriptionCitrus sinensis miR399e stem-loop
Literature search

4 open access papers mention csi-MIR399e
(12 sentences)

Stem-loop
   --caaaugaaucaag   u      c   a        u     a        u    gc   gag 
5'                ugu uagaug auu cugggcaa ucucu uuggcagu ggcu  agg   g
                  ||| |||||| ||| |||||||| ||||| |||||||| ||||  |||   a
3'                acg gucuac uaa ggcccguu agagg aaccguca ucga  ucc   g
   uuuauaauccuacua   u      u   c        u     a        c    --   aac 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Csi_valencia_1.0; GCA_000317415.1) Overlapping transcripts
chr2: 2305516-2305646 [+]
intergenic
Clustered miRNAs
< 10kb from csi-MIR399e
csi-MIR399fchr2: 2298474-2298644 [-]
csi-MIR399cchr2: 2303898-2304046 [-]
csi-MIR399echr2: 2305516-2305646 [+]
Database links

Mature sequence csi-miR399e-5p

Accession MIMAT0048933
Sequence

31 - 

gggcaauucucuauuggcagu

 - 51

Get sequence
Evidence experimental; Illumina [1]

Mature sequence csi-miR399e-3p

Accession MIMAT0048934
Sequence

81 - 

ugccaaaggagauuugcccgg

 - 101

Get sequence
Evidence experimental; Illumina [1]

References

1
PMID:28054378 "MicroRNA annotation of plant genomes - Do it right or not at all" Taylor RS, Tarver JE, Foroozani A, Donoghue PC Bioessays. [Epub prior to print](2017).