Stem-loop sequence csi-MIR398b

AccessionMI0039668 (change log)
DescriptionCitrus sinensis miR398b stem-loop
Literature search

3 open access papers mention csi-MIR398b
(8 sentences)

Stem-loop
   -                     a     --u      c      uu  -  aa    u    a 
5'  gagaagucccgcaggggcgac ugaga   cacaug aacgca  gc cu  ugcc auac u
    ||||||||||||||||||||| |||||   |||||| ||||||  || ||  |||| |||| g
3'  uucuuuaggguguccccgcug acucu   guguau uugugu  ug ga  gugg ugug u
   c                     g     ugu      -      -u  u  gg    -    g 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Csi_valencia_1.0; GCA_000317415.1) Overlapping transcripts
chr2: 28957195-28957316 [+]
intergenic
Database links

Mature sequence csi-miR398b-3p

Accession MIMAT0048932
Sequence

90 - 

uguguucucaggucgccccug

 - 110

Get sequence
Evidence experimental; Illumina [1]

References

1
PMID:28054378 "MicroRNA annotation of plant genomes - Do it right or not at all" Taylor RS, Tarver JE, Foroozani A, Donoghue PC Bioessays. [Epub prior to print](2017).