Stem-loop sequence csi-MIR396f

AccessionMI0039667 (change log)
DescriptionCitrus sinensis miR396f stem-loop
Literature search

1 open access papers mention csi-MIR396f
(1 sentences)

Stem-loop
   cauuauuauuau         -------      c                   a      cu  u   --  a  a   c     u    c 
5'             uaaguccug       gucaug uuuuccacagcuuucuuga cuucca  gu ugc  ug uu aua acggc cuug u
               |||||||||       |||||| ||||||||||||||||||| ||||||  || |||  || || ||| ||||| |||| a
3'             guuuaggac       cgguac agagggugucgaaagaacu gagggu  cg gcg  ac ag ugu ugccg ggau g
   -----cucgucc         uuccaca      a                   c      ac  c   cc  -  a   a     c    c 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Csi_valencia_1.0; GCA_000317415.1) Overlapping transcripts
chr4: 3340888-3341059 [-]
intergenic
Clustered miRNAs
< 10kb from csi-MIR396f
csi-MIR396fchr4: 3340888-3341059 [-]
csi-MIR396bchr4: 3335321-3335454 [+]
Database links

Mature sequence csi-miR396f-5p

Accession MIMAT0048930
Sequence

31 - 

uuccacagcuuucuugaacuu

 - 51

Get sequence
Evidence experimental; Illumina [1]

Mature sequence csi-miR396f-3p

Accession MIMAT0048931
Sequence

122 - 

gcucaagaaagcugugggaga

 - 142

Get sequence
Evidence experimental; Illumina [1]

References

1
PMID:28054378 "MicroRNA annotation of plant genomes - Do it right or not at all" Taylor RS, Tarver JE, Foroozani A, Donoghue PC Bioessays. [Epub prior to print](2017).