Stem-loop sequence csi-MIR396e

AccessionMI0039666 (change log)
DescriptionCitrus sinensis miR396e stem-loop
Literature search

1 open access papers mention csi-MIR396e
(1 sentences)

Stem-loop
   ----  aaauuaau     gu   uug    c           u       a   aauua    -      uuuu      c      ca 
5'     gg        uaaag  cuu   caug uuuuccacggc uucuuga cuu     guac gguuaa    uuugug uauuaa  a
       ||        |||||  |||   |||| ||||||||||| ||||||| |||     |||| ||||||    |||||| ||||||  g
3'     cc        guuuu  gaa   guac aaagggugccg aagaacu gaa     cgug cuaauu    aaacgu auaauu  c
   ccca  accgugcu     ug   --a    a           u       c   ----a    a      -ucu      -      aa 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Csi_valencia_1.0; GCA_000317415.1) Overlapping transcripts
chr7: 10780729-10780898 [-]
intergenic
Database links

Mature sequence csi-miR396e-5p

Accession MIMAT0048928
Sequence

31 - 

uuccacggcuuucuugaacu

 - 50

Get sequence
Evidence experimental; Illumina [1]

Mature sequence csi-miR396e-3p

Accession MIMAT0048929
Sequence

120 - 

gcucaagaaugccgugggaaa

 - 140

Get sequence
Evidence experimental; Illumina [1]

References

1
PMID:28054378 "MicroRNA annotation of plant genomes - Do it right or not at all" Taylor RS, Tarver JE, Foroozani A, Donoghue PC Bioessays. [Epub prior to print](2017).